View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10588_low_5 (Length: 241)
Name: NF10588_low_5
Description: NF10588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10588_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 38 - 224
Target Start/End: Complemental strand, 46678686 - 46678487
Alignment:
| Q |
38 |
gctgaatcaccagaatatatgttattagtaagattaagtttgtttgttaacgttattcgagaagagtttgtttgttagttttttaacagttacacaagag |
137 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46678686 |
gctgaatcaccagaatatgtgttattagtaagattaagtttgtttgttaacgttattcgagaagagtttgtttgttagttttttaacagttacacaagag |
46678587 |
T |
|
| Q |
138 |
ttcctattccaacttaaagaagattttgttatgttgtcagt-------------tatatgattattatttggtcttttatcttggttctaggaaaaggtt |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46678586 |
ttcctattccaacttaaagaagagtttgttatgttgtcagttattttatattcatatatgattattatttggtcttttatcttggttctaggaaaaggtt |
46678487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 46678804 - 46678775
Alignment:
| Q |
1 |
atagaactccataattgggaatgttaaata |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46678804 |
atagaactccataattgggaatgttaaata |
46678775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University