View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10588_low_7 (Length: 240)
Name: NF10588_low_7
Description: NF10588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10588_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 85 - 225
Target Start/End: Complemental strand, 42227238 - 42227098
Alignment:
| Q |
85 |
caaccattcattgctgcagaattattnnnnnnntattggtaaataattgttaatttannnnnnnaattcaagtaagnnnnnnnctattttggtcgcaaga |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
42227238 |
caaccattcattgctgcagaattattaaaaaaatattggtaaataattgttaatttatttttttaattcaagtaagaaaaaaactactttggtcgcaaga |
42227139 |
T |
|
| Q |
185 |
gtgaatatttttctgtcaaatgatttgcattgatgatttct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227138 |
gtgaatatttttctgtcaaatgatttgcattgatgatttct |
42227098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 42227372 - 42227304
Alignment:
| Q |
1 |
tctctcctttaataattattctacatgcttgtgtacaatagggggaatacccaatactgagattctccc |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
42227372 |
tctctcctttaataattattctacatgcttgtgtacaacagggggaatacccaataccgagattctccc |
42227304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University