View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_12 (Length: 286)
Name: NF10591_low_12
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 9500748 - 9501007
Alignment:
| Q |
1 |
gacaattaaaatatgattctacttcccataggttaaggagttgactgaacaatttcctgctgctactcctcttgctttggtgctaaaacagtttttagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500748 |
gacaattaaaatatgattctacttcccataggttaaggagttgactgaacaatttcctgctgctactcctcttgctttggtgctaaaacagtttttagca |
9500847 |
T |
|
| Q |
101 |
gaccggagccttgaccagtcctactctggtggattaagttcctactgtttggtatgcannnnnnnnncgtacacaaataattttcgtttcttaatgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
9500848 |
gaccggagccttgaccagtcctactctggtggattaagttcctactgtttggtatgca-ttttttttcgtacac--ataattttcgtttcttaatgaatt |
9500944 |
T |
|
| Q |
201 |
atccagatgtcctttgtgttggagtaacaaattgctgcagcttcccagatagtctatactata |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500945 |
atccagatgtcctttgtgttggagtaacaaattgctgcagcttcccagatagtctatactata |
9501007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University