View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_14 (Length: 271)
Name: NF10591_low_14
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 262
Target Start/End: Complemental strand, 43055714 - 43055469
Alignment:
| Q |
17 |
agcagccaaaataacgaagaggaggctagaccaacaccagtattttaaaatggtactactccacccaagttgtatgccgatgggccatgtccacattgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43055714 |
agcagccaaaataacgaagaggaggctagaccaacaccagtattttaaaatggcactactccacccaagttgtatgcccatgggccatgtccacattgga |
43055615 |
T |
 |
| Q |
117 |
taatctaagactaccgtcaacacattaatccgccattgatcctttccttactcgacctaagttttttattattaaatcaaaacatgcatagattcttcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055614 |
taatctaagactaccgtcaacacattaatctgccattgatcgtttccttactcgacctaagttttttattattaaatcaaaacatgcatagattcttcaa |
43055515 |
T |
 |
| Q |
217 |
tgaatttcctttctatatatacgcacacaccatccatttgttcatc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055514 |
tgaatttcctttctatatatacgcacacaccatccatttgttcatc |
43055469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University