View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_19 (Length: 246)
Name: NF10591_low_19
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 10083278 - 10083362
Alignment:
| Q |
1 |
tccggttggatcattttcaacaaatagttctgagtctttgtcggatggatttggtttaacacttggcatctagcaccaacatatg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10083278 |
tccggttggatcattttcaacaaatagttctgagtctttgtcggatggatttggtttaacacttggcatctagcaccaacatatg |
10083362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 151 - 233
Target Start/End: Original strand, 10083428 - 10083510
Alignment:
| Q |
151 |
tctagacacttgtgatttttagagaataaaatcaattaaaaatgtttgacaatttatgtcgtgatgtcgaggtttttgatgtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10083428 |
tctagacacttgtgatttttagagaataaaatcaattaaaaatgtttgacaatttatgtcgtgatgtcaaggtttttgatgtc |
10083510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 22264080 - 22264148
Alignment:
| Q |
5 |
gttggatcattttcaacaaatagttctgagtctttgtcggatggatttggtttaacacttggcatctag |
73 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
22264080 |
gttggatcagtttcaacaaatgtttctgtgtctttgtcggatggattttgttgaacacttggcatctag |
22264148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 22269760 - 22269692
Alignment:
| Q |
5 |
gttggatcattttcaacaaatagttctgagtctttgtcggatggatttggtttaacacttggcatctag |
73 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
22269760 |
gttggatcagtttcaacaaatgtttctgtgtctttgtcggatggattttgttgaacacttggcatctag |
22269692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 45874652 - 45874720
Alignment:
| Q |
5 |
gttggatcattttcaacaaatagttctgagtctttgtcggatggatttggtttaacacttggcatctag |
73 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
45874652 |
gttgggtcagtttcaacaaatggttctgagtctttgtcgaatggatttggtttaacacttttcatctag |
45874720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University