View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_20 (Length: 244)
Name: NF10591_low_20
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 17 - 125
Target Start/End: Original strand, 41636717 - 41636825
Alignment:
| Q |
17 |
catcaagagagagtttcaactccagctagttagaagaattcagcaaaagccgaatagagagaaattggtgatggtgaatatgaaggagctatgagtgtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41636717 |
catcaagagagagtttcaactccagctagttagaagaattcagcaaaagccgaatagagagaaattggtgatggtgaatatgaaggagctatgagtgtga |
41636816 |
T |
|
| Q |
117 |
tttgagtgg |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
41636817 |
tttgagtgg |
41636825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 168 - 243
Target Start/End: Original strand, 41636854 - 41636929
Alignment:
| Q |
168 |
gttgttgttgggtcatctgtgaagtaaaacttctctctttctttctttcgattcggacatcatttacccaaccgac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41636854 |
gttgttgttgggtcatctgtgaagtaaaacttctctctttctttctttcggttcggacatcatttacccaaccgac |
41636929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University