View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_22 (Length: 241)
Name: NF10591_low_22
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 126 - 182
Target Start/End: Complemental strand, 446982 - 446926
Alignment:
| Q |
126 |
ctttagccctgtcatcaaacctcaaacaatgaagattgttctcggcattgctctctc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
446982 |
ctttagccctgtcatcaaacctcaaacaatcaagattgttctctgcattgctctctc |
446926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University