View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10591_low_22 (Length: 241)

Name: NF10591_low_22
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10591_low_22
NF10591_low_22
[»] chr2 (1 HSPs)
chr2 (126-182)||(446926-446982)


Alignment Details
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 126 - 182
Target Start/End: Complemental strand, 446982 - 446926
Alignment:
126 ctttagccctgtcatcaaacctcaaacaatgaagattgttctcggcattgctctctc 182  Q
    |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||    
446982 ctttagccctgtcatcaaacctcaaacaatcaagattgttctctgcattgctctctc 446926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University