View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_26 (Length: 237)
Name: NF10591_low_26
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 7905104 - 7904902
Alignment:
| Q |
17 |
agacggggtggagtgtacctgataaagaacttcgcgaagacctacaaatatcggtttctcagaaagttattcctgcttaccgaagttatacaggtagaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
7905104 |
agacggggtggagtgtacctgataaagaacttcgcgaagacctacaaatatcggtttctcagaaattgattcctgcttaccgaagttatacaggtagaaa |
7905005 |
T |
|
| Q |
117 |
ctcgtctaacattgatgagaagtggatcaagtatacggtcgatgatctacaatgttatattttggatctttttcatggttcacaaaaatctttgcaccat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905004 |
ctcgtctaacattgatgagaagtggatcaagtatacggtcgatgatctacaatgttatattttggatctttttcatggttcacaaaaatctttgcaccat |
7904905 |
T |
|
| Q |
217 |
tct |
219 |
Q |
| |
|
||| |
|
|
| T |
7904904 |
tct |
7904902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University