View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10591_low_27 (Length: 233)
Name: NF10591_low_27
Description: NF10591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10591_low_27 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 9300264 - 9300495
Alignment:
| Q |
1 |
actaatgatcatcctatgaggactagagccaagtctggcattgtgcagcctagactgaagcccactttgttacttactatgaatctaaaattgctaaaca |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9300264 |
actaatgatcgtcctatgaggactagagccaagtctggctttgtgcagcctagactgaagcccactttgttccttactatgaatctaaaattgctaaaca |
9300363 |
T |
 |
| Q |
101 |
agcactctataaacccccaatggcatgctactatgcaagaagagtttgattcattagaaagaaataacacttgggattgggtttctctcccaacaaaaag |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9300364 |
agcactctataaacccc-aatggcatgctactatgcaagaagagtttgattcattagaaagaaataacacttgagatggggtttctctcccaacaaaaag |
9300462 |
T |
 |
| Q |
201 |
aaccgccatatataggatgcaaatgggtattca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9300463 |
aaccgccatatataggatgcaaatgggtattca |
9300495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University