View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10592_low_2 (Length: 353)
Name: NF10592_low_2
Description: NF10592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10592_low_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 353
Target Start/End: Complemental strand, 4676884 - 4676550
Alignment:
| Q |
19 |
acataatccactatggtgaaatggcacaagcaacatacgatgctttcaacacagagaaagcatcaaagtttgcaggtagttgtaggtatgcaaagaatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676884 |
acataatccactatggtgaaatggcacaagcaacatacgatgctttcaacacagagaaagcatcaaagtttgcaggtagttgtaggtatgcaaagaatga |
4676785 |
T |
 |
| Q |
119 |
tttcttttctaaagnnnnnnnagaaaatggaaatccttttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgttccggaagcgttt |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676784 |
tttcttttctaaagtttttttagaaaatggaaatccttttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgttccggaagcgttt |
4676685 |
T |
 |
| Q |
219 |
attataaagtctttatctagagaagcttggagtaaggaatcaaattggattggatttgttgctgtggctaatgatgaagggaaagatgtgttggggagaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676684 |
attataaagtctttatctagagaagcttggagtaaggaatcaaattggattggatttgttgctgtggctaatgatgaagggaaagatgtgttggggagaa |
4676585 |
T |
 |
| Q |
319 |
gggatattgtgattgcttggagaggaacgattcaa |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676584 |
gggatattgtgattgcttggagaggaacgattcaa |
4676550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University