View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10594_high_5 (Length: 218)
Name: NF10594_high_5
Description: NF10594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10594_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25583866 - 25583667
Alignment:
| Q |
1 |
agaagagttgagtcatcaccaacaagatcagcaacagtgtcacctacatccccaccaagttcatgtgtgtccactgagctaaaccaagaagatggaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583866 |
agaagagttgagtcatcaccaacaagatcagcaacagtgtcacctacatccccaccaagttcatgtgtgtccactgagctaaaccaagaagatggaaaca |
25583767 |
T |
|
| Q |
101 |
accaacagagatactctaacagcccagaagccacttccatggttttggttggttgtcctcgttgtcttatgtatgtcatgctttctgaagatgatccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583766 |
accaacagagatactctaacagcccagaagccacttccatggttttggttggttgtcctcgttgtcttatgtatgtcatgctttctgaagatgatccaaa |
25583667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 200
Target Start/End: Original strand, 42894075 - 42894155
Alignment:
| Q |
120 |
cagcccagaagccacttccatggttttggttggttgtcctcgttgtcttatgtatgtcatgctttctgaagatgatccaaa |
200 |
Q |
| |
|
|||||| ||||| || |||||| | || || ||||||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
42894075 |
cagccctgaagcaacctccatgctgttagtaggttgtcctcgttgtctcatgtatgtgatgctctctgagaatgatccaaa |
42894155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University