View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10594_high_6 (Length: 206)
Name: NF10594_high_6
Description: NF10594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10594_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 187
Target Start/End: Original strand, 2022178 - 2022352
Alignment:
| Q |
13 |
aagaaacaaatataggatgggaaacataaaacataaaacaatgccaaatgaatttagcaaagttacaattaaggaagaggtggaaagatgattccatgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2022178 |
aagaaacaaatataggatgggaaacataaaacataaaacaatgccaaatgaatttagcaaagttacaattaaggaagcggtggaaagatgattccatgtt |
2022277 |
T |
 |
| Q |
113 |
gaagccacaaagactgcacatggaaggaagttgacgtcctcttctggctagagtttcattagtagataacttatc |
187 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2022278 |
ggagccacaaagactgcacatggaaggaagttgacgtcctcttctggctagagtttcattagtagataacttatc |
2022352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University