View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10594_low_4 (Length: 257)
Name: NF10594_low_4
Description: NF10594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10594_low_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 33680040 - 33680280
Alignment:
| Q |
17 |
cacagactctaccagcagaaagtttttggactggctttacagtcaatatacccaggcacataaacttagttgcactctgccagatcctgattcttatgct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33680040 |
cacagactctaccagcagaaagtttttggactggctttacagtcaatatacccaggcacataaacttagttgcactctgccagatcctgattcttatgct |
33680139 |
T |
|
| Q |
117 |
tattccgtcttcacatttttgttaacttcttttcccatttgcagttggtttttatcattagcatgggtctgtccaagcaagtaagtccctttgctttagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33680140 |
tattccgtcttcacatttttgttaacttcttttcccatttgcagttggtttttatcattagcatgggtctgtccaagcaagtaagtccctttgctttagg |
33680239 |
T |
|
| Q |
217 |
ttttaattcttaaagtagcttatcgattattcttgggcatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33680240 |
ttttaattcttaaagtagcttatcgattgttcttgggcatt |
33680280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University