View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10595_low_1 (Length: 368)
Name: NF10595_low_1
Description: NF10595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10595_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 18 - 357
Target Start/End: Original strand, 45190587 - 45190926
Alignment:
| Q |
18 |
gaaaatgagcaatagtgccaatagtttggatggttttttctctgttgatggaaaatataaaggaccaagtgtaacatccaacgtaatgaaaattgttgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45190587 |
gaaaatgagcaatagtgccaatagtttggatggttttttctctgttgatggaaaatataaaggaccaagtgtaacatccaacgtaatgaaaattgttgct |
45190686 |
T |
 |
| Q |
118 |
attgctggtttggtattggctgtgatatcattgttgttactagtagtgatgtatattaggtggttaaaaagacctttagattggaaagaaagtagaggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45190687 |
attgctggtttggtattggctgtgatatcattgttgttactagtagtgatgtatattaggtggttaaaaagacctttagattggaaagaaagtagaggtt |
45190786 |
T |
 |
| Q |
218 |
tctcttcatggctcttacctctttgtccaaaatctnnnnnnngttgcagtgcaaacgcaaatgcatttgattcacctaagaataagcatggtggtcatga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45190787 |
tctcttcatggctcttacctctttgtccaaaatctaaaaaaagttgcagtgcaaacgcaaatgcatttgattcacctaagaataagcatggtggtcatga |
45190886 |
T |
 |
| Q |
318 |
tgttcatcactctccaagagggacaggaaggttctttcat |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45190887 |
tgttcatcactctccaagagggacaggaaggttctttcat |
45190926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University