View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10595_low_10 (Length: 241)
Name: NF10595_low_10
Description: NF10595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10595_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 30081199 - 30080962
Alignment:
| Q |
1 |
atagttttcgcatagttgaatggatcaaatcaaactattagaatttagaatagtcgaagatgctttaagatgaacattacacaataaaataatc-tactg |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30081199 |
atagttttcgcatggttgaatggatcaaatcaaactattagaatttagaatagtcgaagatgctttaagatgaacattacacaataaaataatcatactg |
30081100 |
T |
|
| Q |
100 |
agtaggaagttaaatttaccagacctagtagttgctagcatttcctccataacagacaaaattgtcatttgccagtgtcaagtcataccaaaaataatgc |
199 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30081099 |
agtaggaagttaagtttaccaaacctagtggttgctagcatttccttcataacagacaaaattgtcatttgccagtgtcaagtcataccaaaaataatgc |
30081000 |
T |
|
| Q |
200 |
tacaagatttgtccgaaaagaaacttctgatgtccatc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
30080999 |
tacaagatttgtccgaaaagaaacttctggtatccatc |
30080962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University