View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10595_low_13 (Length: 237)
Name: NF10595_low_13
Description: NF10595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10595_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 30081188 - 30081407
Alignment:
| Q |
1 |
tgcgaaaactatggttagtatagttaaaaccatttgtgcttaatccttaagcaaataaaccatttcagtaatggacaaggtccagaccaacaagttgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30081188 |
tgcgaaaactatggttagtatagttaaaaccatttgtgcttaatccttaagcaaataaaccatttcagtaaaggacaaggtccagaccaacaagttgtta |
30081287 |
T |
 |
| Q |
101 |
tacgtggttttgattttctcactgtctagtagtatccataatcaaatagtttgaacatgtcacatattgacgatgattgacaaggaaaatcctgtacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30081288 |
tacgtggttttgattttctcactgtctagtagtatccataatca---agtttgaacatgtcacatattgacgatgattgacaaggaaaatcctgtacata |
30081384 |
T |
 |
| Q |
201 |
gaggctagagctatatgaatact |
223 |
Q |
| |
|
|| |||||||| ||||||||||| |
|
|
| T |
30081385 |
gaagctagagccatatgaatact |
30081407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University