View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10595_low_15 (Length: 212)
Name: NF10595_low_15
Description: NF10595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10595_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 40212505 - 40212327
Alignment:
| Q |
14 |
atgaaattgtatatattagtattaggatttgcaaaatgcaataagtatttctgtattttacgttgccgtccaaaatctgaaccgcgttaaagaaatccca |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40212505 |
atgacattgtatatattagtattaggatttgcaaaatgcaataagtatttctgtattttacgttgccgtccaaaatctgaaccgcgttaaagaaatccca |
40212406 |
T |
 |
| Q |
114 |
acagaaaaccgtgttgacatgttttctgttttgagttctaagggaagtgaattaatattttataagatacatattattt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40212405 |
acagaaaaccgtgttgacatgttttctgttttgagttctaagggaagtgaattaatattttataagatacatattattt |
40212327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University