View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10595_low_9 (Length: 241)
Name: NF10595_low_9
Description: NF10595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10595_low_9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 3081961 - 3082184
Alignment:
| Q |
18 |
agaacttaccatgataatatcagcatgtgaagctgatgtatattttctcaaagtaatttactattccccaccaaaataaagaggtttatttcaaaaagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3081961 |
agaacttaccatgataatatcagcatgtgaagctgatgtatattttctcaaagtaatttactattccccaccaaaataaagaggtttatttcaaaaagct |
3082060 |
T |
|
| Q |
118 |
tagtggcggaagagagatattgcaagtttgaaccctaacccacgtagtaaatatccctgcaatattttactatatgaactacgagacagacaaaccaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3082061 |
tagtggcggaagagagatattgcaagtttgaaccctaacccacgtagtaaatatcccttccatattttactatatgaactacgagacaaacaaaccaacc |
3082160 |
T |
|
| Q |
218 |
ctattttaatcaacctatagaaaa |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3082161 |
ctattttaatcaacctatagaaaa |
3082184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University