View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10596_high_7 (Length: 298)
Name: NF10596_high_7
Description: NF10596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10596_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 44735377 - 44735136
Alignment:
| Q |
7 |
gaagcataggggctgaagggttagacttagaa------ggcacatctactccttatttgatgtcaatttgattcccaacaaatcaagaattattgctata |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44735377 |
gaagtataggggctgaagggttagacttagaactagaaggcacatctactccttatttgatgtcaatttaattcccaacaaatcaagaattattgctata |
44735278 |
T |
 |
| Q |
101 |
gttactgccttgttggttttggaaactactatatcttaggagagcccatattccctttctcaacattaggcgataatcactcaagaggtcaaatggtaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44735277 |
gttactgccttgttggttttggaaactactatatcttaggagagcccatattccctttctcaacattcggcgataatcactcaagaggtcaaatggtaca |
44735178 |
T |
 |
| Q |
201 |
aggtaatcattctgcacatatcactaataattcatatgtacc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735177 |
aggtaatcattctgcacatatcactaataattcatatgtacc |
44735136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University