View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10596_low_19 (Length: 242)
Name: NF10596_low_19
Description: NF10596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10596_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 10490516 - 10490301
Alignment:
| Q |
19 |
accattgatatttctgtgtctatttctctgtgttgctgtccttgtgtacatccttgctcgaagggatgaataatttgccaacttattgtttctgtcagcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10490516 |
accattgatatttctgtgtctatttctctgtgttgctgtccttgtgtacattcttgctcgaagggatgaataatttgccaacttattgtttctttcagcc |
10490417 |
T |
|
| Q |
119 |
tatgatgcatccatatgggccgccatatgcaccaccattttattcacatggaggggtttatactcatcctgccgttgccatcgtaagtttacattctcgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10490416 |
tatgatgcatccatatgggccgccatatgcaccaccattttattcacatggaggggtttatactcatcctgccgttgccatcgtaagtttacattctcgc |
10490317 |
T |
|
| Q |
219 |
aatattggcctatgct |
234 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
10490316 |
aatattggcttatgct |
10490301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University