View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10596_low_24 (Length: 238)
Name: NF10596_low_24
Description: NF10596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10596_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 3 - 217
Target Start/End: Complemental strand, 7450990 - 7450781
Alignment:
| Q |
3 |
aaatttgtatgttgtagttttaatgtatcgagtactaagattaattgggatttgggggttttgttttatgaatgggggaaatcatgaatcatgcatagag |
102 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450990 |
aaatttgtatgttttagttttaatgtat-gagtactaagtttgattgggatttgggggttttgttttatgaatgggggaaatcatgaatcatgcatagag |
7450892 |
T |
 |
| Q |
103 |
ttttaggtatttgatgttatgcatgttgaattgatgtatgctgcataatgaagttaagtatctttttgtaatatttatgaatgattgtttaggattcgta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| |||||||||| |
|
|
| T |
7450891 |
ttttaggtatttgatgttatgcatgttgaattgatgtatgctgcataatgaagttaagtatttttctctaatatttatgaatgatcgtttaggatt---- |
7450796 |
T |
 |
| Q |
203 |
ttgcatgatctatga |
217 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7450795 |
ttgcatgatctatga |
7450781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University