View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10596_low_28 (Length: 221)
Name: NF10596_low_28
Description: NF10596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10596_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 27009250 - 27009056
Alignment:
| Q |
19 |
gaagcaacctattctctgatttccaatattcaagcttttcaataatcttaaggtattggattacaaaattctctaacctcatagtttctttttctatgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27009250 |
gaagcaacctattctctgatttccaatattcaagcttttcaataatcttaaggtattggattacaaaattctctaacctcatagtttctttttctatgaa |
27009151 |
T |
|
| Q |
119 |
tgaaatctctctatcgaagaactcgacgcgagatgtttcgagtgacaacatgtttttcatttctctaagcatagattctttttctttcatctcac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27009150 |
tgaaatctctctatcgaagaactcgacgcgagatgtttcgagtgataacatgtttttcatttctctaagcatagattctttttctttcatttcac |
27009056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University