View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10596_low_8 (Length: 307)
Name: NF10596_low_8
Description: NF10596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10596_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 3908084 - 3908374
Alignment:
| Q |
18 |
ggaaaaaattaaatccttagttgattttattttattaaaaatttgggtaggttcattcatgcaaagggtaaaagatcgccgttgttttggtcaaggtaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3908084 |
ggaaaaaattaaatccttagttgattttattttattaaaaatttgggtaggttcattcatgcaaagggtaaaagatcgccgttgttttggtcaaggtaga |
3908183 |
T |
|
| Q |
118 |
ttttgatattaattttgcagagacaagtagaagaatttcttaattcagactc-----------aaaaaatcaaacttttcaaacacttttcccttaatag |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3908184 |
ttttcatattaattttgcagagacaagtagaacaatttcttaattcagactcaaaaaaatccgaaaaaatcaaacttttcaaacacttttcccttaatgg |
3908283 |
T |
|
| Q |
207 |
ttgaatcgtaagaaaaaccagaaaccaaccaatagcagtagcaaccggtttttgttttgttatttttgattataaatatggcacgtctctg |
297 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3908284 |
ttgcatcgtaagaaaaaccagaaaccaaccaatagcagtagcaaccggtttttgttttcttatttttgattataaatatggcacgtctctg |
3908374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University