View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10597_high_2 (Length: 242)
Name: NF10597_high_2
Description: NF10597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10597_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 85 - 224
Target Start/End: Original strand, 8629798 - 8629937
Alignment:
| Q |
85 |
ataagataaggttatagatgaatttcattttcatttgtttgattgttttgtgaagttaattgtaaaggggtgtttttgcaatgcctgatgattcatactg |
184 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8629798 |
ataagataaggttataaatgaatttcattttcatttgtttgattgttttgtgaagttaattgtaaaggggtgtttttgcaatgtctgatgattcatactg |
8629897 |
T |
 |
| Q |
185 |
catctatgnnnnnnnnnggttggtgtttacctagactttg |
224 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |
|
|
| T |
8629898 |
catctatgtttttttttggttggtgtttacctagactttg |
8629937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University