View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10598_low_10 (Length: 262)
Name: NF10598_low_10
Description: NF10598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10598_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 119 - 255
Target Start/End: Original strand, 8369315 - 8369454
Alignment:
| Q |
119 |
aatatataatagctaaatgtgtgaacaagaagagaataggtcagataagggaaaactgttgact-aggtgttacattttgacattctttggttttttcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| | | | |
|
|
| T |
8369315 |
aatatataatagctaaatgtgtgaacaagaagagaataggtcagataagggaaaactgttgactaaggtgttacatgttgacattctttggtttgtacgt |
8369414 |
T |
 |
| Q |
218 |
a--aaaattcaactcttactgttcaaacattttcatctca |
255 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8369415 |
aataaaattcaactcttactgttcaaacattttcatctca |
8369454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 250
Target Start/End: Complemental strand, 8421542 - 8421514
Alignment:
| Q |
222 |
attcaactcttactgttcaaacattttca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8421542 |
attcaactcttactgttcaaacattttca |
8421514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University