View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10598_low_13 (Length: 249)
Name: NF10598_low_13
Description: NF10598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10598_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 1971788 - 1971565
Alignment:
| Q |
16 |
cagattcatggtcattctttggttcagcttgcatttacttgcttaaggtgttaaaa-ctcatgtgcaataaaatatattggtgcttgttgtattgacttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971788 |
cagattcatggtcattctttggttcagcttgcatttacttgcttaaggtgttaaaaactcatgtgcaataaaatatattggtgcttgttgtattgacttg |
1971689 |
T |
|
| Q |
115 |
tctagtaaatctatgcatgtaatagttatttttgcatcacacctatctatggttgcttcctgcttcaaatttaaatttgcaagatgcttgaattccaaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1971688 |
tctagtaaatctatgcatgtaatagttatttttgcatcacacctatctatggttgcttcctgcttcaaatttaaatttgtaagatgcttgaattccaaca |
1971589 |
T |
|
| Q |
215 |
gtagttttatgatcttcctttctt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1971588 |
gtagttttatgatcttcctttctt |
1971565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University