View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10598_low_17 (Length: 220)
Name: NF10598_low_17
Description: NF10598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10598_low_17 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 30147842 - 30147656
Alignment:
| Q |
15 |
cagagatgagtgcaacagggggattagggtgggtgttaaaccagtggataattggagtttggagattggagagggcgttaatgaaaggatagtttccagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30147842 |
cagagatgagtgcaacagggggattagggtgggtgttaaaccagtggataattggactttggagattggaaagggcgttaatgaaaggatagtttccagt |
30147743 |
T |
|
| Q |
115 |
gttaccgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaaagggagaatgagtgtttggatggtgtttgg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30147742 |
gttaccgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaaagggagaatgagtgtttggatggtgtttgg |
30147656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 141771 - 141952
Alignment:
| Q |
20 |
atgagtgcaacagggggattagggtgggtgttaaaccagtggataattggagtttggagattggagagggcgttaatgaaaggatagtttccagtgttac |
119 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||| ||||| ||||| |||| |||||||| || ||||||||||||||||||||||| | ||| | |
|
|
| T |
141771 |
atgagagcaacagggggattatggtggatgttaaaccactggattattgggttttgaagattggaaagtgcgttaatgaaaggatagtttccggggtttc |
141870 |
T |
|
| Q |
120 |
cgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaaagggagaatgagtgtttggatggtgtttgg |
201 |
Q |
| |
|
||| | ||||| |||||| ||||| |||||||| |||||||||||||| |||| || ||||||| ||| |||||||| |
|
|
| T |
141871 |
cgatttcacggagattttcaacatctgagggtattttggggtgtgaagggaatgggaagattagtgttttgattgtgtttgg |
141952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University