View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10598_low_5 (Length: 353)
Name: NF10598_low_5
Description: NF10598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10598_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 93 - 221
Target Start/End: Original strand, 5554965 - 5555093
Alignment:
| Q |
93 |
cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5554965 |
cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta |
5555064 |
T |
|
| Q |
193 |
tatactcaattagaagtttgagaagatgt |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
5555065 |
tatactcaattggaagtttgagaagatgt |
5555093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 213 - 337
Target Start/End: Original strand, 5555123 - 5555247
Alignment:
| Q |
213 |
agaagatgtggcattagtgctaattataattcattactcacatcatcatccaataggggaagagacataaatataagtctcagatgaccaagacaataca |
312 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5555123 |
agaagatgtggcattagtgctaataataattcattactcacatcattatccaattggggaagagacataaatataagtctcagaggaccaagacaataca |
5555222 |
T |
|
| Q |
313 |
tcgccataagaaatagggttctatg |
337 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5555223 |
tcgccataagaaatagggttctatg |
5555247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University