View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10598_low_9 (Length: 282)
Name: NF10598_low_9
Description: NF10598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10598_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 9490312 - 9490568
Alignment:
| Q |
18 |
gaagtatccatgtaaagtggagaattaattgaagctgcacagcttataaatgctatggtttctaagttattagtatctaacaagctataaggtttatcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9490312 |
gaagtatccatgtaaagtggagaattaattgaagctgcacagcttataaatgctatggtttctaagttattagtatctaacaagctataaggtttatcag |
9490411 |
T |
|
| Q |
118 |
tggtgaagttttcatttgttaaagtgtatagaggaattgaagaacaaatttctttgttcagacctgaatctatgatccttattgtggaatttttgtagtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9490412 |
tggtgaagttttcatttgttaaagtgtatagaggaattgaagagcaattttctttgttcagacctgaatctatgatccttattgtggaatttttgtagtt |
9490511 |
T |
|
| Q |
218 |
gatggattctacaaagtactttccattgtatagatttagtattgtttgattcttctc |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9490512 |
gatggattctacaaagtattttccattgtatagatttagtattgtttgattgttctc |
9490568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University