View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10599_low_11 (Length: 359)
Name: NF10599_low_11
Description: NF10599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10599_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 4 - 198
Target Start/End: Complemental strand, 16233533 - 16233331
Alignment:
| Q |
4 |
agagagatgaattagaaaaactaaggaataaaataaaaa--------cgcataacaccttgcttattccaaaccacaccaaattatcgcgaaatcgtctt |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16233533 |
agagaaatgaattagaaaaactaaggaataaaataaaaatataaaaacgcataacaccttgcttattccaaaccacaccaaattatcgcgaaatcgtctt |
16233434 |
T |
|
| Q |
96 |
tctcttccctccgaatcctagggtttgtgcttcgcaaaatcctctttctcttccttccgaattctagggtttcagcgcagattcctctttctcttgtagt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16233433 |
tctcttccctccgaatcctagggtttgtgcttcgcaaaatcctctttctcttccttccgaattctagggtttcagcgcagattcctctttctcttgtagt |
16233334 |
T |
|
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
16233333 |
tta |
16233331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 290 - 348
Target Start/End: Complemental strand, 16233228 - 16233170
Alignment:
| Q |
290 |
ggaggtttgttttaagtgaattatgtaatgggttctgaggtttatttatggtgtctgtg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16233228 |
ggaggtttgttttaagtgaattatgtaatgggttctgaggtttatttatggtgtttgtg |
16233170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University