View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10599_low_22 (Length: 245)
Name: NF10599_low_22
Description: NF10599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10599_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 7023187 - 7022945
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggattagaatataagaaaatagtatctcataatatatattatgaagaagcaaaaccacatttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023187 |
ctctccttttacctgggcttgggaccgaccttagcaggattagaatataagaaaatagtatctcataatatatattatgaagaagcaaaaccacatttgg |
7023088 |
T |
|
| Q |
101 |
tctgttttgagataaaattagtggttcaataaacatctcaaaaccgtctctaaatgataaaaaatctctagagattgactatagaccaatatattgtaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023087 |
tctgttttgagataaaattagtggttcaataaacatctcaaaaccgtctctaaatgataaaaaatctctagagattgactatagaccaatatattgtaaa |
7022988 |
T |
|
| Q |
201 |
caaagtagatgtcaataaacatctcaactgtatacctatgctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7022987 |
caaagtagatgtcaataaacatctcaactgtataactatgctt |
7022945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 51450821 - 51450861
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggatt |
41 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
51450821 |
ctctccttttacccgggcttgggaccggccttggcaggatt |
51450861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 52136355 - 52136315
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggatt |
41 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
52136355 |
ctctccttttacccgggcttgggaccggccttggcaggatt |
52136315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 200
Target Start/End: Complemental strand, 11123746 - 11123627
Alignment:
| Q |
84 |
agcaaaaccacatttggtctgttttgagataaaattagtggttcaataaacatctcaaaaccgtctctaaatgataaaaaat----ctctagagattgac |
179 |
Q |
| |
|
|||||||||||| ||| | ||||||||| |||||| |||| ||||||||||||||| ||||||||| |||| || ||| || ||||| ||||||| |
|
|
| T |
11123746 |
agcaaaaccacagttgacccgttttgagaaaaaattggtggctcaataaacatctcagaaccgtctcaaaat-atgaaacatggtcctctacggattgac |
11123648 |
T |
|
| Q |
180 |
tatagaccaatatattgtaaa |
200 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11123647 |
tatagaccaatatattgtaaa |
11123627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 49350528 - 49350569
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggatta |
42 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
49350528 |
ctctccttttacctgggcttgggaccggccttggcaggatta |
49350569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 75
Target Start/End: Complemental strand, 11124919 - 11124884
Alignment:
| Q |
40 |
ttagaatataagaaaatagtatctcataatatatat |
75 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11124919 |
ttagaatataagaaaatagtatctcattatatatat |
11124884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 52921019 - 52920978
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggatta |
42 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
52921019 |
ctctccttttacccgggcttgggaccggccttggcaggatta |
52920978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 42
Target Start/End: Original strand, 16538809 - 16538849
Alignment:
| Q |
2 |
tctccttttacctgggcttgggaccgaccttagcaggatta |
42 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
16538809 |
tctccttttaccagagcttgggaccgaccttggcaggatta |
16538849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 37520631 - 37520590
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggatta |
42 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
37520631 |
ctctccttttacccgggcttgggaccggccttggcaggatta |
37520590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 1648048 - 1648008
Alignment:
| Q |
1 |
ctctccttttacctgggcttgggaccgaccttagcaggatt |
41 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
1648048 |
ctctccttttacccgggcttgggaccggccttggcaggatt |
1648008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University