View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10599_low_23 (Length: 241)
Name: NF10599_low_23
Description: NF10599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10599_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 33 - 226
Target Start/End: Complemental strand, 7646850 - 7646653
Alignment:
| Q |
33 |
ggatcatgccgttcactctcactttattttctatttctctcttaatcttactatcttgattattt----nnnnnnnntaaaattgatgaattaatgtaaa |
128 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
7646850 |
ggatcatgccgtttactctcactttattttctatttctctcttaatcttactatcttgattattttaaaaaaaaaaaaaaaaatgatgaattaatgtaaa |
7646751 |
T |
|
| Q |
129 |
tgaagtcggtgatctaatttcgagtnnnnnnnnnnnntagagagaaatctcaaccagatgattgtgcagctgagaaaagaggaaaagtgcataatatt |
226 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7646750 |
tgaagacggtgatctaatttcgagtaaaaaataaaaatagagagaaatctaaaccagatgattgtgcagctgagaaaagaggaaaagtgcataatatt |
7646653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University