View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10599_low_25 (Length: 233)
Name: NF10599_low_25
Description: NF10599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10599_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 30700653 - 30700855
Alignment:
| Q |
13 |
gagatgaataaacccactctaaattttctcatgaaccacattacaataaatctcaatatgtttagttttctcatgaaannnnnnnttatgggcaaaataa |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
30700653 |
gagatgaataaacccactctagattttctcatgaaccacatgacaatgaatctcaatatatttagttctctcatgaaagggggg-ttatgggcaaaataa |
30700751 |
T |
|
| Q |
113 |
attgtagatttgttgtcacaacaatagtgaaaggcaagttat-aaaaagtaatacgcatgtcacgaaacaaatattgctaccactgcaattcacaagaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30700752 |
attgtagatttgttgtcacaacaatagtgaaaggcaagttatgaaaaagtaatacgcatgtcacgaaacaaatattgcaaccactgcaattcacaagaga |
30700851 |
T |
|
| Q |
212 |
gtct |
215 |
Q |
| |
|
|||| |
|
|
| T |
30700852 |
gtct |
30700855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 90
Target Start/End: Original strand, 35517068 - 35517145
Alignment:
| Q |
13 |
gagatgaataaacccactctaaattttctcatgaaccacattacaataaatctcaatatgtttagttttctcatgaaa |
90 |
Q |
| |
|
||||||||||| |||||| | ||||||||| | ||||| | ||||| ||||||||| ||||| ||| |||||||||| |
|
|
| T |
35517068 |
gagatgaataagcccactttggattttctcacggaccacgtgacaatcaatctcaatgtgtttggttctctcatgaaa |
35517145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University