View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10599_low_26 (Length: 232)
Name: NF10599_low_26
Description: NF10599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10599_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 33121480 - 33121685
Alignment:
| Q |
8 |
gagagaagaaagtgagaggagaatatttatgctgagatcggatctggtaatctctgagctgttcaacaagtttagaacgggttatcatctcaaatcaata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33121480 |
gagagaagaaagtgagaggagaatatttatgctgagatcggatctggtaatctctgagctgttcaacaagtttagaacgggttatcatctcaaatcaata |
33121579 |
T |
|
| Q |
108 |
accctttttaactaactaacaacttattcactcgttaacccaattaaacggtgtttgtctcagatcatgtagatgctatgttactgttaaccattaacaa |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33121580 |
accctttttaactaactaacaacttcttcactcgttaacccaattaaacggtgtttgtctcagatcatgtagatgctatgttactgttaaccgttaacaa |
33121679 |
T |
|
| Q |
208 |
gcattt |
213 |
Q |
| |
|
|||||| |
|
|
| T |
33121680 |
gcattt |
33121685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University