View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10599_low_29 (Length: 221)
Name: NF10599_low_29
Description: NF10599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10599_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 9628307 - 9628508
Alignment:
| Q |
1 |
atagcagtagcagtatggctatctaatttcatatgttgtatttgtgcatgtgcatgttacattaactgggctggaatatttaagataacaacttctgcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9628307 |
atagcagtagcagtatggctatctaatttcatatgttgtatttgtgcatgtgcatgttacattaactgggctagaatatttaagataacaacttctgcac |
9628406 |
T |
 |
| Q |
101 |
cctagttttttcttctatactcccctttattaccgttccggctttcccattttgcctttgatctaaaagtaaatacctagacagatatatgttagagact |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9628407 |
cctagttttttcttctatactcccttttattaccgttccggctttcccattttgcctttggtctaaaagtaaatacctagacagatatatgttagagact |
9628506 |
T |
 |
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
9628507 |
at |
9628508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University