View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10600_high_4 (Length: 226)
Name: NF10600_high_4
Description: NF10600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10600_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 205
Target Start/End: Original strand, 40660500 - 40660676
Alignment:
| Q |
23 |
gcatgtcaacactctgcttgaattgaagttaacaaacatgccaatgaaaatcaatgctgaggcgcataacatcccaaccaattgtcaagtcgtccaaact |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660500 |
gcatgtcaacactctgcttgaattgaagttaacaaacatgccaatgaaaatcaatgttgaggcgcataacatcccaaccaattgtcaagtcgtccaaact |
40660599 |
T |
 |
| Q |
123 |
aaatttcagtagaataatatatttccatcattgcacttgcacagcatggtgagtactcagttgcctcgttttttatatgtttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660600 |
aaatttcagtagaataatatatttccatca------ttgcacagcatggtgagtactcagttgcctcgttttttatatgtttg |
40660676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 23 - 205
Target Start/End: Complemental strand, 40625559 - 40625386
Alignment:
| Q |
23 |
gcatgtcaacactctgcttgaattgaagttaacaaacatgccaatgaaaatcaatgctgaggcgcataacatcccaaccaattgtcaagtcgtccaaact |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||| ||| || ||||| |
|
|
| T |
40625559 |
gcatgtcaacactctgcttgagttgaagttaacaaacatgccaatggatatcaatgctgaggcgcataacatcccacccaattgtctagtggttaaaact |
40625460 |
T |
 |
| Q |
123 |
aaatttcagtagaataatatatttccatcattgcacttgcacagcatggtgagtactcagttgcctcgttttttatatgtttg |
205 |
Q |
| |
|
|| |||||||| ||||||||||||||| |||||| |||||||||||||||||| |||| |||||| ||||||| |
|
|
| T |
40625459 |
aatcttcagtag---aatatatttccatca------ctgcacaacatggtgagtactcagtttcctcattttttggatgtttg |
40625386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 23 - 136
Target Start/End: Original strand, 40639735 - 40639857
Alignment:
| Q |
23 |
gcatgtcaacactctgcttgaattgaagttaacaaacatgccaatgaaaatcaatgctgaggcgcataacatcccaa---------ccaattgtcaagtc |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| | ||||||||| ||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
40639735 |
gcatgtcaacactctgctagaattgaagttaacagacatgccaagggaaatcaatgatgaggcgcagaacatcccaacattcctacccaattgtcgagtc |
40639834 |
T |
 |
| Q |
114 |
gtccaaactaaatttcagtagaa |
136 |
Q |
| |
|
||| ||||||| ||||||||||| |
|
|
| T |
40639835 |
gtctaaactaattttcagtagaa |
40639857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University