View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10600_low_11 (Length: 245)
Name: NF10600_low_11
Description: NF10600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10600_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 29671542 - 29671330
Alignment:
| Q |
18 |
agaaatatatttacggtgaaaacagatttggcggggagcctctatttttaccgaattctgattctgagaacgaagatgatggttatattttgacatttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671542 |
agaaatatatttacggtgaaaacagatttggcggggagcctctgtttttaccaaattccgattctgagaacgaagatgatggttatattttgacatttgt |
29671443 |
T |
|
| Q |
118 |
tcatgatgagaaagaatggaaatcagaattgcagattgtgaatgctgctactttgaagcttgaagcttctattcagcttccttctcgtgttccttatgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671442 |
tcatgatgagaaagaatggaaatcagaattgcagattgtgaatgctgctactttgaagcttgaagcttctattcagcttccttctcgtgttccttatgga |
29671343 |
T |
|
| Q |
218 |
tttcatggaactt |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29671342 |
tttcatggaactt |
29671330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University