View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10600_low_12 (Length: 241)
Name: NF10600_low_12
Description: NF10600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10600_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 6125809 - 6125590
Alignment:
| Q |
1 |
ctcattcataaattgactatgcagatagcttcccacaattttggacgtgttcatggattgtatgcaaaattggaaaggcttcgtgctcgagttgaagtaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
6125809 |
ctcattcataaattgactatg---atagctttccacaattttggacgtgttcatggattgtatgcaaaattggaaaggcttcgtgctggagttgaagaaa |
6125713 |
T |
|
| Q |
101 |
tcaaagcaatttttgaggatgatcacaacaaaattgacaaggattggataagagagataaaagatcaggtttatgctgctgatgacttcttcgatgaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6125712 |
tcaaagcaatttttgaggatgatcagagaaaaattgacaaggattggataagagagataaaagatcaggtttatgctgctgatgacttcttcgatgaaat |
6125613 |
T |
|
| Q |
201 |
tgctaccgaaattttgcgtcttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6125612 |
tgctaccgaaattttgcgtcttg |
6125590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University