View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10600_low_13 (Length: 241)
Name: NF10600_low_13
Description: NF10600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10600_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 46318435 - 46318221
Alignment:
| Q |
18 |
acataaaattcatggatcgtaaattgaattgaattaaattaaatctgtgatggaatcaaattgaaatggaacctacctggatgaatcagagagggaggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46318435 |
acataaaattcatggatcgtaaattgaattgaattaaattaaatctgtgatggaatcaaattgaaatggaacctacctggatgaatcagagagggaggaa |
46318336 |
T |
|
| Q |
118 |
gaagaataaaaatcggaatcggaggagtagcggtgatgcttgcgacgtcgtttggcgtgagagtgagacttagatttctttcggatcttaagggagtctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46318335 |
gaagaataaaaatcggaatcggaggagtagcggtgatgcttgcgacgtcgttttgcgtgagagtgagacttagatttctttcggatcttaagggagtcct |
46318236 |
T |
|
| Q |
218 |
tgttgtcgcggtctc |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46318235 |
tgttgtcgcggtctc |
46318221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University