View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10600_low_15 (Length: 227)
Name: NF10600_low_15
Description: NF10600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10600_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 213
Target Start/End: Complemental strand, 39673362 - 39673164
Alignment:
| Q |
15 |
caaagggcctataaatccatcaactgattgtgaagcatatcggtataccagcaactttgtacggcattgggcacattttcaatatgaatttccagttcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39673362 |
caaagggcctataaatccatcaactgattgtgaagcatatcggtataccagcaactttgtacggcattgggcagattttcaatatgaatttccagttcat |
39673263 |
T |
|
| Q |
115 |
ctttttggtttgactaacaagaaaatggacctaaaaattaatatgatatgacagtggtcagaaattaaacaggtttcgttctttgttccaagtagtttt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39673262 |
ctttttggtttgactaacaagaaaatggacctaaaaattaatatgatatgacagtggtcagaatttaaacaggtttcgttctttgttccaagtagtttt |
39673164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University