View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10601_high_5 (Length: 206)

Name: NF10601_high_5
Description: NF10601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10601_high_5
NF10601_high_5
[»] chr1 (1 HSPs)
chr1 (12-194)||(46453302-46453484)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 46453484 - 46453302
Alignment:
12 agcagagaaggcataaagagacttactgaaaacggtaattagggagcatagccatannnnnnnaaatgacttcaacaacaaaatttggagtgatcgacca 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
46453484 agcaaagaaggcataaagagacttactgaaaacggtaattagggagcatagccatattttttaaaatgacttcaacaacaaaatttggagtgatcgacca 46453385  T
112 ccaatgagtgttatgaaaagaaatacaaaagaacgttaacatgttagattaaacgttgtcttccttgtagatatgagaaactt 194  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46453384 ccaatgagtgttatgaaaataaatacaaaagaacgttaacatgttagattaaacgttgtcttccttgtagatatgagaaactt 46453302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University