View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10601_low_19 (Length: 220)
Name: NF10601_low_19
Description: NF10601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10601_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 19541532 - 19541725
Alignment:
| Q |
19 |
acaatgtattgttgaattatttcccaaacataagacatttcggtttaggttttggggcttggcttgtgatggaatattctatctacacggattgggttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19541532 |
acaatgtattgttgaattatttcccaaacataagacatctcagtttaggttttggggcttggcttgtgatggaatattctgtctacacggattgggttaa |
19541631 |
T |
|
| Q |
119 |
agacattgaaagatcttgctgcacaatatggacattgaaagattttaaataacttgtcattgtattgtgcatctcattggtatctctgcttctc |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
19541632 |
agacattgaaggatcttgctgcacaatatggacattgaaagattttaaataacttgtcattgtattgtgcatctcattggtatctttgtttctc |
19541725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University