View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10601_low_20 (Length: 217)
Name: NF10601_low_20
Description: NF10601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10601_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 24154227 - 24154026
Alignment:
| Q |
1 |
aaaaacacaaaagggtcttataattagggagataggtagtataaatcacaactcataagagggaannnnnnnnn-gttcttgaaatatcatattggggaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24154227 |
aaaaacacaaaagggtcttataattagggagagaggtagtataaatcacaatttataagagggaacattttttttgttcttgaaatatcatattggggaa |
24154128 |
T |
|
| Q |
100 |
cctgtgagccggggcagactcattcaatggttatgtgtgactaaagctacacgtctaattttctctttttatataaataaagcacaatatgttgaaaata |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
24154127 |
cctgtgagccggggtgaactcattcaatggttatgtgtgactaaagctacacgtctaattttctttttttatataaataaaacacaatatgttgaaaata |
24154028 |
T |
|
| Q |
200 |
ag |
201 |
Q |
| |
|
|| |
|
|
| T |
24154027 |
ag |
24154026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University