View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10601_low_21 (Length: 216)

Name: NF10601_low_21
Description: NF10601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10601_low_21
NF10601_low_21
[»] chr1 (1 HSPs)
chr1 (12-171)||(35889840-35889999)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 171
Target Start/End: Complemental strand, 35889999 - 35889840
Alignment:
12 aagcagagagtgttaaggctacgccggtgaagaaagcggcgaagaaggtggttgcaaagaagccgaagagtgttaagactccggtgaagaaagctaagaa 111  Q
    ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35889999 aagcaaagagtgtgaaggctacgccggtgaagaaagcggcgaagaaggtggttgcaaagaagccgaagagtgttaagactccggtgaagaaagctaagaa 35889900  T
112 gtgaaaattagggtttaatttggggatttttagtgatgtgtgaaatttgagggtttatta 171  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
35889899 gtgaaaattagggtttaatttgggaatttttagtgatgtgtgaaatttgagggtttatta 35889840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University