View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10601_low_21 (Length: 216)
Name: NF10601_low_21
Description: NF10601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10601_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 171
Target Start/End: Complemental strand, 35889999 - 35889840
Alignment:
| Q |
12 |
aagcagagagtgttaaggctacgccggtgaagaaagcggcgaagaaggtggttgcaaagaagccgaagagtgttaagactccggtgaagaaagctaagaa |
111 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35889999 |
aagcaaagagtgtgaaggctacgccggtgaagaaagcggcgaagaaggtggttgcaaagaagccgaagagtgttaagactccggtgaagaaagctaagaa |
35889900 |
T |
|
| Q |
112 |
gtgaaaattagggtttaatttggggatttttagtgatgtgtgaaatttgagggtttatta |
171 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35889899 |
gtgaaaattagggtttaatttgggaatttttagtgatgtgtgaaatttgagggtttatta |
35889840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University