View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_high_21 (Length: 302)
Name: NF10602_high_21
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 37742348 - 37742630
Alignment:
| Q |
1 |
aacttgaacaaatcgtggcatgttttatcaacgcattttttcggtacaaatttatttttgtccaaaaataaaatgaaattgagaattggcacggtagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37742348 |
aacttgaacaaatcgtggcatgttttatcaatgcattttttcggtacaaatttatttttgtctaaaaataaaatgaaattgagaattgacacggtagata |
37742447 |
T |
|
| Q |
101 |
atttacttataaaattgagaaggaaattaattagatgaaatgattcaatcgaagaaaaatgaaaagtagctcttctccgacacaacctcaaattgcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37742448 |
atttacttataaaattgagaaggaaattaattagatgaaatgattcaatcgaagaaaaatgaaaagtagctcttctccgacacaacctcaaattacacct |
37742547 |
T |
|
| Q |
201 |
aatgatcacatgtgggtagttatgatttatgatttattatgagaaggattaaatttcagtctcttgttgattatggtggcggt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37742548 |
aatgatcacatgtgggtagttatgatttatgatttattatgagaaggattaaatttcagtctcttgttgattatggtggcggt |
37742630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University