View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_high_38 (Length: 251)
Name: NF10602_high_38
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 40953276 - 40953498
Alignment:
| Q |
18 |
tgctttgtgtcaatcatcctcactttcactttcctataatagtaagaaacattcttgataactattacagatgttttgcttcttttacgtgtttattctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953276 |
tgctttgtgtcaatcatcctcactttcactttcctacaatagtaagaaacattcttgataactattacagatgttttgcttcttttacgtgtttattctt |
40953375 |
T |
 |
| Q |
118 |
tttggattagccataaatagaaaacagtacatttttaaattgatgtctcctccaatgtcccaactcttagataataataaataaataaattgaagttact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40953376 |
tttggattagccataaatagaaaacagtacatttttaaattgatgtctcctccaatgtcccaactcttagataatattaaataaataaattgaagttact |
40953475 |
T |
 |
| Q |
218 |
ctaattattttatcatacttcat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40953476 |
ctaattattttatcatacttcat |
40953498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University