View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10602_high_55 (Length: 240)

Name: NF10602_high_55
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10602_high_55
NF10602_high_55
[»] chr4 (55 HSPs)
chr4 (18-240)||(42684683-42684905)
chr4 (129-205)||(400566-400642)
chr4 (145-204)||(12869046-12869105)
chr4 (126-205)||(22845445-22845524)
chr4 (154-213)||(35609737-35609796)
chr4 (154-205)||(52559574-52559625)
chr4 (127-205)||(6218446-6218524)
chr4 (127-205)||(34358029-34358107)
chr4 (154-239)||(35609516-35609601)
chr4 (127-212)||(50859008-50859092)
chr4 (127-231)||(50828207-50828311)
chr4 (129-204)||(5846154-5846229)
chr4 (154-205)||(9279234-9279285)
chr4 (129-204)||(14783188-14783263)
chr4 (129-204)||(21498803-21498878)
chr4 (127-202)||(22231307-22231382)
chr4 (126-205)||(22863481-22863560)
chr4 (154-205)||(28245552-28245603)
chr4 (154-205)||(28246111-28246162)
chr4 (126-205)||(35788901-35788980)
chr4 (154-212)||(7572728-7572786)
chr4 (127-205)||(11036510-11036588)
chr4 (161-219)||(13555500-13555558)
chr4 (127-205)||(22827545-22827623)
chr4 (127-205)||(35788666-35788744)
chr4 (127-205)||(39902562-39902640)
chr4 (127-205)||(50543566-50543644)
chr4 (159-204)||(21498362-21498407)
chr4 (160-205)||(22822357-22822402)
chr4 (154-211)||(25324059-25324116)
chr4 (154-207)||(27464274-27464327)
chr4 (160-205)||(35796774-35796819)
chr4 (154-239)||(44118885-44118970)
chr4 (161-204)||(5846387-5846430)
chr4 (129-204)||(9685640-9685715)
chr4 (154-205)||(22231099-22231150)
chr4 (129-204)||(25052860-25052935)
chr4 (154-204)||(1518172-1518222)
chr4 (154-204)||(6218212-6218262)
chr4 (154-212)||(6666226-6666284)
chr4 (161-203)||(17222685-17222727)
chr4 (160-210)||(21646297-21646347)
chr4 (127-205)||(21685005-21685083)
chr4 (154-212)||(25323824-25323882)
chr4 (161-199)||(40726734-40726772)
chr4 (127-205)||(50543329-50543407)
chr4 (154-204)||(53814955-53815005)
chr4 (159-220)||(6666666-6666727)
chr4 (159-204)||(20821981-20822026)
chr4 (127-204)||(40717440-40717517)
chr4 (159-204)||(53814705-53814750)
chr4 (161-205)||(2221001-2221045)
chr4 (160-204)||(12005501-12005545)
chr4 (162-210)||(21041353-21041401)
chr4 (161-205)||(27634549-27634593)
[»] chr5 (37 HSPs)
chr5 (136-239)||(7369697-7369800)
chr5 (126-205)||(17352433-17352512)
chr5 (127-205)||(18333464-18333542)
chr5 (127-205)||(24346500-24346578)
chr5 (152-220)||(25436193-25436261)
chr5 (146-205)||(37782068-37782127)
chr5 (126-205)||(41666755-41666834)
chr5 (126-212)||(60087-60173)
chr5 (127-205)||(41666992-41667070)
chr5 (127-205)||(15480564-15480644)
chr5 (161-205)||(12034697-12034741)
chr5 (160-239)||(170583-170662)
chr5 (154-205)||(24528547-24528598)
chr5 (127-205)||(24269870-24269947)
chr5 (154-239)||(7092123-7092207)
chr5 (128-205)||(9368602-9368679)
chr5 (160-204)||(24487677-24487721)
chr5 (127-205)||(18333698-18333777)
chr5 (126-205)||(19705910-19705989)
chr5 (154-205)||(24531606-24531657)
chr5 (154-205)||(24647703-24647754)
chr5 (127-194)||(25258093-25258160)
chr5 (127-194)||(25321883-25321950)
chr5 (129-204)||(27132994-27133069)
chr5 (129-204)||(42295587-42295662)
chr5 (159-205)||(15480329-15480375)
chr5 (154-204)||(19522095-19522145)
chr5 (154-220)||(37405081-37405147)
chr5 (160-205)||(2061970-2062015)
chr5 (164-205)||(6637609-6637650)
chr5 (159-204)||(26137140-26137185)
chr5 (129-202)||(29909722-29909795)
chr5 (129-181)||(8287832-8287884)
chr5 (160-212)||(12151943-12151995)
chr5 (154-202)||(24270131-24270179)
chr5 (154-202)||(24346763-24346811)
chr5 (160-204)||(33337270-33337314)
[»] chr8 (51 HSPs)
chr8 (127-220)||(38475739-38475832)
chr8 (172-233)||(8466532-8466593)
chr8 (129-204)||(17469826-17469901)
chr8 (129-204)||(17477073-17477148)
chr8 (154-205)||(24532447-24532498)
chr8 (130-204)||(4828301-4828375)
chr8 (154-212)||(38476277-38476335)
chr8 (146-239)||(42049705-42049798)
chr8 (161-204)||(7267498-7267541)
chr8 (129-204)||(19256587-19256662)
chr8 (129-204)||(24075307-24075382)
chr8 (154-205)||(38447453-38447504)
chr8 (154-205)||(39052955-39053006)
chr8 (159-205)||(5931980-5932026)
chr8 (154-212)||(10614965-10615023)
chr8 (127-205)||(11232193-11232271)
chr8 (127-205)||(11232428-11232506)
chr8 (127-205)||(15042669-15042747)
chr8 (127-205)||(35682780-35682858)
chr8 (158-212)||(37868378-37868432)
chr8 (154-239)||(8466750-8466835)
chr8 (128-205)||(8929024-8929101)
chr8 (154-207)||(37001231-37001284)
chr8 (159-212)||(37868614-37868667)
chr8 (161-205)||(7729948-7729992)
chr8 (127-207)||(37001469-37001549)
chr8 (126-205)||(10450007-10450086)
chr8 (129-204)||(19256821-19256896)
chr8 (126-201)||(27205171-27205246)
chr8 (126-193)||(39960211-39960278)
chr8 (161-212)||(44931215-44931266)
chr8 (154-204)||(4828076-4828126)
chr8 (129-239)||(5590369-5590479)
chr8 (161-239)||(5940031-5940109)
chr8 (159-212)||(6541914-6541968)
chr8 (127-233)||(20301240-20301346)
chr8 (127-233)||(21087872-21087978)
chr8 (130-200)||(26800514-26800584)
chr8 (127-201)||(27204975-27205049)
chr8 (127-201)||(27205073-27205147)
chr8 (154-204)||(34843125-34843175)
chr8 (158-212)||(37867862-37867916)
chr8 (158-212)||(37868102-37868156)
chr8 (154-204)||(39984822-39984872)
chr8 (127-204)||(42846604-42846682)
chr8 (129-182)||(4963384-4963437)
chr8 (162-239)||(12022422-12022499)
chr8 (154-207)||(22638205-22638258)
chr8 (159-212)||(40014658-40014711)
chr8 (160-204)||(6559481-6559525)
chr8 (159-203)||(30201555-30201599)
[»] chr1 (29 HSPs)
chr1 (160-239)||(52676305-52676384)
chr1 (127-233)||(31181512-31181618)
chr1 (154-238)||(52907358-52907442)
chr1 (127-212)||(50695833-50695918)
chr1 (127-205)||(4113005-4113083)
chr1 (159-205)||(26173255-26173301)
chr1 (127-205)||(40079159-40079237)
chr1 (126-202)||(26865356-26865432)
chr1 (129-204)||(3169774-3169849)
chr1 (126-205)||(52650769-52650848)
chr1 (154-204)||(12244988-12245038)
chr1 (129-202)||(17452680-17452753)
chr1 (159-204)||(41035858-41035903)
chr1 (159-239)||(4098433-4098513)
chr1 (164-212)||(7465681-7465729)
chr1 (154-202)||(17452854-17452902)
chr1 (159-219)||(38668353-38668413)
chr1 (163-239)||(43480346-43480422)
chr1 (154-205)||(25713400-25713451)
chr1 (161-212)||(31004470-31004521)
chr1 (154-205)||(39348378-39348429)
chr1 (129-204)||(51589000-51589075)
chr1 (161-239)||(9146587-9146665)
chr1 (159-205)||(16163174-16163220)
chr1 (127-193)||(31432229-31432295)
chr1 (127-205)||(35772271-35772349)
chr1 (154-204)||(51589234-51589284)
chr1 (160-205)||(2859659-2859704)
chr1 (127-212)||(9146863-9146948)
[»] chr6 (30 HSPs)
chr6 (129-204)||(27656466-27656541)
chr6 (127-239)||(33494512-33494624)
chr6 (154-233)||(6542969-6543048)
chr6 (127-205)||(4868576-4868654)
chr6 (127-205)||(4868812-4868890)
chr6 (127-205)||(9705027-9705105)
chr6 (129-204)||(8026397-8026472)
chr6 (154-205)||(9705261-9705312)
chr6 (129-204)||(21690730-21690805)
chr6 (127-205)||(13353208-13353286)
chr6 (154-204)||(19712722-19712772)
chr6 (154-204)||(27772722-27772772)
chr6 (127-205)||(33796333-33796411)
chr6 (127-204)||(11721913-11721990)
chr6 (129-202)||(24554127-24554200)
chr6 (159-204)||(27653225-27653270)
chr6 (154-202)||(28867983-28868031)
chr6 (154-205)||(2753265-2753316)
chr6 (159-202)||(17147691-17147734)
chr6 (128-239)||(30256551-30256662)
chr6 (126-204)||(13740924-13741002)
chr6 (126-204)||(13746424-13746502)
chr6 (154-204)||(25065120-25065170)
chr6 (160-205)||(3680253-3680298)
chr6 (159-204)||(6400877-6400922)
chr6 (129-194)||(8026622-8026687)
chr6 (160-205)||(12330211-12330256)
chr6 (159-204)||(19712960-19713005)
chr6 (159-204)||(27772954-27772999)
chr6 (160-204)||(12199837-12199881)
[»] chr3 (45 HSPs)
chr3 (127-205)||(35038193-35038271)
chr3 (127-205)||(54567899-54567977)
chr3 (154-231)||(23610397-23610474)
chr3 (129-205)||(13574922-13574998)
chr3 (161-232)||(34221740-34221811)
chr3 (159-205)||(50083112-50083158)
chr3 (127-204)||(1723075-1723152)
chr3 (127-204)||(8018976-8019053)
chr3 (129-204)||(11589793-11589868)
chr3 (154-205)||(45138828-45138879)
chr3 (127-205)||(4155331-4155409)
chr3 (127-201)||(7697397-7697471)
chr3 (127-205)||(16926948-16927026)
chr3 (154-204)||(20327875-20327925)
chr3 (127-205)||(31317473-31317551)
chr3 (162-239)||(39269304-39269381)
chr3 (154-239)||(45828219-45828304)
chr3 (154-202)||(20327640-20327688)
chr3 (160-204)||(20479016-20479060)
chr3 (127-239)||(22729073-22729185)
chr3 (160-204)||(23691224-23691268)
chr3 (160-204)||(23708024-23708068)
chr3 (160-204)||(23708256-23708300)
chr3 (160-204)||(23726480-23726524)
chr3 (160-204)||(23726712-23726756)
chr3 (160-204)||(23744936-23744980)
chr3 (160-204)||(23745168-23745212)
chr3 (160-204)||(24063461-24063505)
chr3 (160-204)||(24063693-24063737)
chr3 (154-205)||(472086-472137)
chr3 (160-227)||(1681690-1681757)
chr3 (154-205)||(45138997-45139048)
chr3 (154-205)||(54368523-54368574)
chr3 (154-204)||(9272969-9273019)
chr3 (159-205)||(16239598-16239644)
chr3 (127-204)||(16239835-16239912)
chr3 (127-205)||(31317236-31317313)
chr3 (127-204)||(45828027-45828104)
chr3 (154-202)||(1800225-1800273)
chr3 (142-202)||(20303078-20303138)
chr3 (160-204)||(23691456-23691500)
chr3 (127-187)||(24866222-24866282)
chr3 (159-187)||(28087246-28087274)
chr3 (163-239)||(41915144-41915220)
chr3 (154-210)||(50930704-50930760)
[»] chr2 (42 HSPs)
chr2 (126-205)||(16419509-16419588)
chr2 (126-205)||(40379207-40379286)
chr2 (142-204)||(2324482-2324544)
chr2 (161-239)||(8227322-8227400)
chr2 (127-205)||(36352158-36352236)
chr2 (127-205)||(40379443-40379521)
chr2 (127-204)||(28407792-28407869)
chr2 (154-205)||(37840344-37840395)
chr2 (154-204)||(2324248-2324298)
chr2 (127-205)||(5711438-5711516)
chr2 (127-205)||(5711674-5711752)
chr2 (160-202)||(15988223-15988265)
chr2 (159-205)||(17525369-17525415)
chr2 (127-205)||(17719407-17719485)
chr2 (154-204)||(32884115-32884165)
chr2 (155-205)||(33606316-33606366)
chr2 (154-226)||(25082563-25082635)
chr2 (160-212)||(30006611-30006663)
chr2 (160-212)||(30063299-30063351)
chr2 (154-205)||(2029776-2029827)
chr2 (154-205)||(2030011-2030062)
chr2 (129-204)||(19191611-19191686)
chr2 (154-205)||(42639640-42639691)
chr2 (154-204)||(5509087-5509137)
chr2 (127-205)||(14466409-14466487)
chr2 (154-204)||(17854955-17855005)
chr2 (159-205)||(19544402-19544447)
chr2 (154-204)||(29718336-29718386)
chr2 (154-204)||(37769969-37770019)
chr2 (154-204)||(40718233-40718283)
chr2 (160-201)||(93479-93520)
chr2 (160-201)||(93752-93793)
chr2 (160-205)||(94052-94097)
chr2 (159-204)||(5509321-5509366)
chr2 (129-202)||(8424898-8424971)
chr2 (160-205)||(16533554-16533599)
chr2 (126-203)||(17719575-17719652)
chr2 (159-204)||(17854723-17854768)
chr2 (164-225)||(18208975-18209036)
chr2 (127-187)||(10570995-10571055)
chr2 (159-239)||(15988386-15988465)
chr2 (159-239)||(33606085-33606165)
[»] scaffold0334 (1 HSPs)
scaffold0334 (142-204)||(4443-4505)
[»] chr7 (35 HSPs)
chr7 (127-205)||(25620143-25620221)
chr7 (127-204)||(21054952-21055029)
chr7 (127-212)||(40898921-40899006)
chr7 (136-233)||(47849550-47849647)
chr7 (160-204)||(23839109-23839153)
chr7 (129-204)||(26562074-26562149)
chr7 (129-204)||(34027401-34027476)
chr7 (154-205)||(48243087-48243138)
chr7 (161-219)||(9689123-9689181)
chr7 (127-205)||(47710450-47710528)
chr7 (127-205)||(47722106-47722184)
chr7 (154-239)||(1793721-1793804)
chr7 (159-204)||(10882036-10882081)
chr7 (127-204)||(34027635-34027712)
chr7 (129-205)||(29469612-29469688)
chr7 (129-205)||(29469847-29469923)
chr7 (127-207)||(30727117-30727197)
chr7 (154-205)||(3038110-3038161)
chr7 (145-212)||(21213058-21213125)
chr7 (127-194)||(32474518-32474585)
chr7 (127-202)||(33996310-33996385)
chr7 (154-204)||(2544473-2544523)
chr7 (154-204)||(10903093-10903143)
chr7 (127-233)||(15317532-15317637)
chr7 (142-204)||(23794370-23794432)
chr7 (127-205)||(26239915-26239993)
chr7 (154-212)||(32292519-32292577)
chr7 (127-205)||(43085536-43085614)
chr7 (163-204)||(4268062-4268103)
chr7 (159-216)||(38843024-38843081)
chr7 (161-205)||(4454783-4454827)
chr7 (164-204)||(4886337-4886377)
chr7 (161-205)||(35308179-35308223)
chr7 (160-204)||(40746506-40746550)
chr7 (161-205)||(44874379-44874423)
[»] scaffold0041 (1 HSPs)
scaffold0041 (127-212)||(67278-67363)
[»] scaffold0129 (1 HSPs)
scaffold0129 (154-205)||(14310-14361)
[»] scaffold0005 (1 HSPs)
scaffold0005 (129-204)||(56467-56542)
[»] scaffold0519 (2 HSPs)
scaffold0519 (127-205)||(1923-2001)
scaffold0519 (127-205)||(2158-2236)
[»] scaffold0083 (1 HSPs)
scaffold0083 (127-205)||(51243-51321)
[»] scaffold0003 (1 HSPs)
scaffold0003 (154-212)||(347597-347655)
[»] scaffold0766 (1 HSPs)
scaffold0766 (154-205)||(6281-6332)
[»] scaffold0048 (1 HSPs)
scaffold0048 (126-205)||(82083-82162)
[»] scaffold0692 (2 HSPs)
scaffold0692 (127-205)||(5543-5621)
scaffold0692 (127-205)||(5753-5831)
[»] scaffold0481 (1 HSPs)
scaffold0481 (154-204)||(3497-3547)
[»] scaffold0400 (1 HSPs)
scaffold0400 (129-193)||(3864-3928)
[»] scaffold0365 (1 HSPs)
scaffold0365 (129-193)||(4508-4572)


Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 55)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 42684683 - 42684905
Alignment:
18 aagttgactcgggttgtgcagtgtaattttacctgtaaatagttgttttttgatagcatttgtaacaactcgcaaaatggaatcttagagagagggaaca 117  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42684683 aagttgactcgagttgtgcagtgtaattttacctataaatagttgttttttgatagcatttgtaacaactcgcaaaatggaatcttagagagagggaaca 42684782  T
118 cgaaaaggctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaacca 217  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
42684783 cgaaaaggctcttagaacttgtgcttgagcctaactcaacgccacaaaaccggcttgtgaggtgatgattgcccccatttataaacacttgttcaaacca 42684882  T
218 tctgttatccaatgtgtgactcc 240  Q
    | |||||||||||||||||||||    
42684883 tttgttatccaatgtgtgactcc 42684905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 205
Target Start/End: Original strand, 400566 - 400642
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||| ||||| |||||| || | ||||  ||||||||||||||||||||||| ||||||||||| ||||||||||    
400566 ttagaaattgtggttgagcttaacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacac 400642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 145 - 204
Target Start/End: Original strand, 12869046 - 12869105
Alignment:
145 agcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | |||| ||||||||||||||||||||||||||||| |||||| |||||||||    
12869046 agcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 12869105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 205
Target Start/End: Original strand, 22845445 - 22845524
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
22845445 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacac 22845524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 35609737 - 35609796
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaa 213  Q
    |||| |||||||||||||||||||||||| ||||  ||||| ||||||||||||||||||    
35609737 caaccccacaaaaccggcttgtgaggtgaggattggccccacttataaacacttgttcaa 35609796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 52559625 - 52559574
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||||||||||||||||||||||||||||| |||||| ||||||||||    
52559625 caaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacac 52559574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 6218524 - 6218446
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||||||||| | |||  ||| ||||||||||||||||||||||||| |||||| ||||||||||    
6218524 tcttagaaatcgtggttgagcctaacacaattccataaaaccggcttgtgaggtgatgattgcccccacttataaacac 6218446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 34358029 - 34358107
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||||||||| | |||| ||||||||||||||| ||| |||| |||| |||||||||||||||||    
34358029 tcttagaaatcgtgtttgagcctaacacaaccccacaaaaccggcttctgatgtgaggattgcccccatttataaacac 34358107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 35609516 - 35609601
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||| ||||||||||| |||||||||||| |||| |||||| ||||||||||||||| |  ||||||   |||||||||| |||||    
35609516 caaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacacttgtttaggccatctcccatccaatgtgggactc 35609601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 50859092 - 50859008
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||| ||||||| ||| ||||| | |||| ||||||| |||||||||||||||| |||||| |||| |||||||||||| ||||    
50859092 tcttagtacttgtgattgtgcctagcacaaccccacaaa-ccggcttgtgaggtgaggatttcacccacttataaacacttattca 50859008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 231
Target Start/End: Original strand, 50828207 - 50828311
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| ||||| ||| ||||| | || | ||||||||||||| ||||||||||||| | | |||| ||||||||||||||| |  |||||| | |||    
50828207 tcttagaatttgtgtttgggcctaacacagccccacaaaaccggcctgtgaggtgatgactactcccacttataaacacttgtttaggccatctctcatc 50828306  T
227 caatg 231  Q
    |||||    
50828307 caatg 50828311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 5846229 - 5846154
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||||||||| | |||| ||||||||||||||| |||||||| |||| |||||| |||||||||    
5846229 ttagaaatcgtggttgagcctaacgcaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaaca 5846154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 9279285 - 9279234
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||| |||||||||||||| |||||| ||||||||||    
9279285 caaccccacaaaaccggctagtgaggtgatgattgcccccacttataaacac 9279234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 14783188 - 14783263
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| ||||||||||||||||||||||||||||| ||| || |||||||||    
14783188 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaaca 14783263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 21498878 - 21498803
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
21498878 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 21498803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 202
Target Start/End: Original strand, 22231307 - 22231382
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||    
22231307 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 22231382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 22863560 - 22863481
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||| ||||| |||| |||||| ||||||||||    
22863560 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacac 22863481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 28245552 - 28245603
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
28245552 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 28245603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 28246111 - 28246162
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
28246111 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 28246162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 35788980 - 35788901
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||||| ||| |||| |||||| ||||||||||    
35788980 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgcccccacttataaacac 35788901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 7572728 - 7572786
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| ||||||| | |||||||||||||| |||| |||||| |||||||||||||||||    
7572728 caaccccacaaagctggcttgtgaggtgaagattacccccacttataaacacttgttca 7572786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 11036510 - 11036588
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||| | ||| | |||| || |||||||||||||||||||||||||| |||| | ||||||||||    
11036510 tcttagaaattgtggttgggtctaacacaaccccgcaaaaccggcttgtgaggtgatgattgccccaacttataaacac 11036588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 13555500 - 13555558
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatc 219  Q
    |||||||||||||||||||||| ||||||||||| |||||| ||| |  ||||||||||    
13555500 acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatc 13555558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 22827623 - 22827545
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| | |||||||||||||||||||||| |||| |||||| ||||||||||    
22827623 tcttagaaatcgtggttgggcctaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 22827545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 35788744 - 35788666
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||| |||||||||||||||||||| |||| |||||| ||||||||||    
35788744 tcttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacac 35788666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 39902562 - 39902640
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||| ||||||||||||| |||| |||||| ||||||||||    
39902562 tcttagaaatggtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacac 39902640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 50543566 - 50543644
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||| ||||    
50543566 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttatacacac 50543644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 21498407 - 21498362
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||||||||| |||| |||||| |||||||||    
21498407 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 21498362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 22822402 - 22822357
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||||||| ||||| ||||||||||| ||||||||||    
22822402 cacaaaaccggcttgtgtggtgaggatttcccccacttataaacac 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 25324059 - 25324116
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttc 211  Q
    |||| |||||||| || ||||||||||||| ||| |||||| ||||||||||||||||    
25324059 caaccccacaaaatcgacttgtgaggtgataattgcccccacttataaacacttgttc 25324116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 27464274 - 27464327
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacactt 207  Q
    |||| |||||||||||||||||||||||| |||| || ||| ||||||||||||    
27464274 caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacactt 27464327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 35796774 - 35796819
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||||||||||||| |||| |||||| ||||||||||    
35796774 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 35796819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 44118885 - 44118970
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||| ||||||||| |||||||||||||| |||| |||||| |||||||||| |  |||  |||||| |||||| ||||| |||||    
44118885 caaccccacaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttatccgatgtgggactc 44118970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 5846430 - 5846387
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||||||| |||| |||||| |||||||||    
5846430 acaaaaccggcttgtgaggtgaggattgcccccacttataaaca 5846387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 9685715 - 9685640
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| ||| |||||||||||||||||||| |||| |||||| |||||||||    
9685715 ttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaaca 9685640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 22231099 - 22231150
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| ||||  ||||| ||||||||||    
22231099 caaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacac 22231150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 25052935 - 25052860
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||  |||| |||||| |||||||||    
25052935 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattacccccacttataaaca 25052860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 1518222 - 1518172
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||| ||| |||| |||||| |||||||||    
1518222 caaccccacaaaaccggcttgtgagctgaggattgcccccacttataaaca 1518172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 6218262 - 6218212
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| ||||||||||| |||||||||||| |||| |||||| |||||||||    
6218262 caactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaaca 6218212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 6666226 - 6666284
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| |||||||||| | ||||||||||| |||| |||||| |||||||||||| ||||    
6666226 caaccccacaaaacctgtttgtgaggtgaggattgcccccaattataaacacttattca 6666284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 17222685 - 17222727
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaac 203  Q
    |||||||||||||||||||||| |||| |||||| ||||||||    
17222685 acaaaaccggcttgtgaggtgaggattgcccccacttataaac 17222727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 21646297 - 21646347
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgtt 210  Q
    |||||||| ||||||| |||||| |||| ||||||||||||||||| ||||    
21646297 cacaaaactggcttgtaaggtgaggattgcccccatttataaacacatgtt 21646347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 21685083 - 21685005
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||| || || | |||| |||||||| ||||||||||||||| |||||  |||| ||||||||||    
21685083 tcttagaaattgtggttgggcttaacacaaccccacaaaatcggcttgtgaggtgaggatttatcccacttataaacac 21685005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 25323824 - 25323882
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| ||||||||||||| || ||||||| |||| ||||||  ||||||||||||||||    
25323824 caaccccacaaaaccggcctgcgaggtgaggattgcccccacgtataaacacttgttca 25323882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 199
Target Start/End: Complemental strand, 40726772 - 40726734
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttat 199  Q
    |||||||||||||||||||||| ||||||||||| ||||    
40726772 acaaaaccggcttgtgaggtgaggatttcccccacttat 40726734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 50543329 - 50543407
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||| ||||| |||| |||||| ||||| ||||    
50543329 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacac 50543407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 53814955 - 53815005
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| ||||||||||| |||||||||||| |||| |||||| |||||||||    
53814955 caaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaaca 53815005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 6666666 - 6666727
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatct 220  Q
    |||||||||||| ||||||||| | |||| |||||| ||  ||||||||||||| |||||||    
6666666 ccacaaaaccggtttgtgaggtaaggattgcccccacttgaaaacacttgttcagaccatct 6666727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 20822026 - 20821981
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||||  ||| |||||| |||||||||    
20822026 ccacaaaaccggcttgtgaggtgagaattgcccccacttataaaca 20821981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 40717440 - 40717517
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||| ||| |||||||| |||| |||||| |||||||||    
40717440 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttttgaggtgaggattgcccccacttataaaca 40717517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 53814705 - 53814750
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||||||||| ||||  ||||| |||||||||    
53814705 ccacaaaaccggcttgtgaggtgaggattatccccacttataaaca 53814750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 2221001 - 2221045
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||| |||| ||||||  |||||||||    
2221001 acaaaaccggcttgtgaggtgaggattgcccccacctataaacac 2221045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 12005501 - 12005545
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||| ||||    
12005501 cacaaaaccggcttgtgaggtgaggattgcccccacttattaaca 12005545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 21041401 - 21041353
Alignment:
162 caaaaccggcttgtgaggtgatgatttcccccatttataaacacttgtt 210  Q
    ||||||||| ||||||||||| ||||| ||||| |||||||||| ||||    
21041401 caaaaccggtttgtgaggtgaggattttccccacttataaacacatgtt 21041353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 27634549 - 27634593
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||| |||| |||||| | ||||||||    
27634549 acaaaaccggcttgtgaggtgaggattgcccccactcataaacac 27634593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 37)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 136 - 239
Target Start/End: Complemental strand, 7369800 - 7369697
Alignment:
136 ttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtg 235  Q
    ||||| ||| ||||| | |||| |||||||||||||||||||||||| || | |||||| |||||||||||||||||  |||||| |||||||||||| |    
7369800 ttgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggactgcccccacttataaacacttgttcatgccatctcttatccaatgtggg 7369701  T
236 actc 239  Q
    ||||    
7369700 actc 7369697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 126 - 205
Target Start/End: Original strand, 17352433 - 17352512
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||||||||| | ||||  |||||||||||||||||||||||||||| |||||| ||||||||||    
17352433 ctcttagaagtggtggttgagcctaacgcaacctcacaaaaccggcttgtgaggtgatgattgcccccacttataaacac 17352512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 18333464 - 18333542
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
18333464 tcttagaatttgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacac 18333542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 24346500 - 24346578
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||||||||| | |||| ||| |||||||||||||||||||| |||| |||||| ||||||||||    
24346500 tcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggattacccccacttataaacac 24346578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 220
Target Start/End: Complemental strand, 25436261 - 25436193
Alignment:
152 ctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatct 220  Q
    |||||| |||||||||||||||||||||||| ||||||||  | |||||||||| ||||||| ||||||    
25436261 ctcaaccccacaaaaccggcttgtgaggtgaggatttcccttacttataaacacatgttcaagccatct 25436193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 146 - 205
Target Start/End: Original strand, 37782068 - 37782127
Alignment:
146 gcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||| |||||| |||||||||| |||||||||||||||||| |||||| ||||||||||    
37782068 gcctaactcaactccacaaaaccagcttgtgaggtgatgattgcccccacttataaacac 37782127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 205
Target Start/End: Original strand, 41666755 - 41666834
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
41666755 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 41666834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 126 - 212
Target Start/End: Complemental strand, 60173 - 60087
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||| ||||| ||| | ||| |  ||| |||||||||||||||||||||||| |||| |||||| |||||||||| ||||||    
60173 ctcttagaaattgtgattgggtctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatgttca 60087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 41666992 - 41667070
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
41666992 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 41667070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 15480644 - 15480564
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatt--tcccccatttataaacac 205  Q
    |||||||| ||||| ||| ||||| | |||| |||||||||||||||||||||||| ||||  ||||||| ||||||||||    
15480644 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacac 15480564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 12034741 - 12034697
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||| |||||||||||||| ||||||||||||||||||||||    
12034741 acaaaactggcttgtgaggtgaggatttcccccatttataaacac 12034697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 239
Target Start/End: Original strand, 170583 - 170662
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||||||||||||||||||| || | |||||| |||||||||| || | | ||||||| || ||| |||||||||||    
170583 cacaaaaccggcttgtgaggtgaggactgcccccacttataaacacatgcttagaccatcttttgtccgatgtgtgactc 170662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 24528598 - 24528547
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
24528598 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 24528547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 24269870 - 24269947
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||||||||| | |||| ||| |||||||||||||||||||| || || ||||| ||||||||||    
24269870 tcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgagga-ttaccccacttataaacac 24269947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 7092207 - 7092123
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||| ||||||||| |||||||||||||| |||| ||||||  | ||||||| |||||   ||||||||||||||||||| |||||    
7092207 caaccccacaaaactggcttgtgaggtgaggattgccccca-ctctaaacacatgttcgggccatctgttatccaatgtgggactc 7092123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 205
Target Start/End: Complemental strand, 9368679 - 9368602
Alignment:
128 cttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||| || || ||| ||||| | |||| |||||||||||||||||||||||| |||| || ||| ||||||||||    
9368679 cttagaaattatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac 9368602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 24487677 - 24487721
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
24487677 cacaaaaccggcttgtgaggtgaggattacccccacttataaaca 24487721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 18333698 - 18333777
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatt-tcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| ||||  |||||| ||||||||||    
18333698 tcttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgattaccccccacttataaacac 18333777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 19705989 - 19705910
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| ||||||||||||||| | |||||| |||| |||||| ||||||||||    
19705989 ctcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttataaggtgaggattgcccccacttataaacac 19705910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 24531657 - 24531606
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||| ||||||||||||||| |||| |||||| ||||||||||    
24531657 caaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacac 24531606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 24647754 - 24647703
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| || ||| ||||||||||    
24647754 caactccacaaaaccggcttgtgaggtgaggattgccaccagttataaacac 24647703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 194
Target Start/End: Original strand, 25258093 - 25258160
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccca 194  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| ||||||    
25258093 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccca 25258160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 194
Target Start/End: Original strand, 25321883 - 25321950
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccca 194  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| ||||||    
25321883 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccca 25321950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 27132994 - 27133069
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| ||| || |||||||||    
27132994 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 27133069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 42295662 - 42295587
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| ||||  ||| ||||| | |||| |||||||||||||||||||||||| |||| | |||| |||||||||    
42295662 ttagaaattgtcgttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgctcccacttataaaca 42295587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 15480375 - 15480329
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||| ||||||||||||| |||| |||||| ||||||||||    
15480375 ccacaaaaccagcttgtgaggtgaggattgcccccacttataaacac 15480329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 19522145 - 19522095
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| | |||||||    
19522145 caaccccacaaaaccggcttgtgaggtgaggattgcccccactaataaaca 19522095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 220
Target Start/End: Complemental strand, 37405147 - 37405081
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatct 220  Q
    |||| ||||||||||||||| |||||||  |||| |||||| ||| |||||||| |||| |||||||    
37405147 caaccccacaaaaccggcttttgaggtggggattgcccccacttacaaacactttttcagaccatct 37405081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 2061970 - 2062015
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||| ||||||||||||||||| |||| |||||| ||||||||||    
2061970 cacaagaccggcttgtgaggtgaagattgcccccacttataaacac 2062015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 205
Target Start/End: Complemental strand, 6637650 - 6637609
Alignment:
164 aaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||||||||| |||| |||||| ||||||||||    
6637650 aaaccggcttgtgaggtgaggattacccccacttataaacac 6637609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 26137140 - 26137185
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||| ||||||| ||| |||| ||||||||||||||||    
26137140 ccacaaaaccggtttgtgagatgaggattgcccccatttataaaca 26137185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 29909722 - 29909795
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| || ||| |||||||    
29909722 ttagaaatggtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcctccacttataaa 29909795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 181
Target Start/End: Complemental strand, 8287884 - 8287832
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtg 181  Q
    |||||| ||||| ||| ||||| | |||| |||||||||||||||||||||||    
8287884 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtg 8287832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 12151943 - 12151995
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||||||||| |  ||||| || |||||||| ||||||||    
12151943 cacaaaaccggcttgtgaggtgagggcttccctcacttataaacccttgttca 12151995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 24270131 - 24270179
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||| ||||||||||||||||||||||||  ||| |||||| |||||||    
24270131 caaccccacaaaaccggcttgtgaggtgagtattacccccacttataaa 24270179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 24346763 - 24346811
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||| ||||||||||||||||||||||||  ||| |||||| |||||||    
24346763 caaccccacaaaaccggcttgtgaggtgagtattacccccacttataaa 24346811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 33337270 - 33337314
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||| ||| |||||||||||||||| |||||| |||||||||    
33337270 cacaaaatcggtttgtgaggtgatgattgcccccacttataaaca 33337314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 51)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 127 - 220
Target Start/End: Complemental strand, 38475832 - 38475739
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatct 220  Q
    |||||||| ||||| ||| ||||| | |||| | |||||||||||||||||||||| |||| |||||| |||||||||||||||||| ||||||    
38475832 tcttagaatttgtggttgggcctaacacaaccctacaaaaccggcttgtgaggtgaggattgcccccacttataaacacttgttcaagccatct 38475739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 233
Target Start/End: Original strand, 8466532 - 8466593
Alignment:
172 ttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtg 233  Q
    ||||||||||| ||||||||||| ||||||||||||||||| ||||||| |||||| |||||    
8466532 ttgtgaggtgaggatttcccccacttataaacacttgttcagaccatctcttatccgatgtg 8466593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 17469901 - 17469826
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||||||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
17469901 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 17469826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 17477148 - 17477073
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||||||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
17477148 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 17477073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 24532447 - 24532498
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||||||||||||||||||||||||||||| |||||| ||||||||||    
24532447 caaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacac 24532498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 204
Target Start/End: Complemental strand, 4828375 - 4828301
Alignment:
130 tagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||| ||||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
4828375 tagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 4828301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 38476335 - 38476277
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| |||||||| ||||||||||||||| ||||||||||| |||||||||||| ||||    
38476335 caaccccacaaaatcggcttgtgaggtgaggatttcccccacttataaacacttattca 38476277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 239
Target Start/End: Original strand, 42049705 - 42049798
Alignment:
146 gcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||| ||||  ||||||||||||||||| ||||| |||| |||||| |||||||||| ||| ||  |||||| || |||||||| ||||||    
42049705 gcctaccacaacctcacaaaaccggcttgtggggtgaggattgcccccacttataaacacatgtccaggccatcttttgtccaatgtttgactc 42049798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 204
Target Start/End: Original strand, 7267498 - 7267541
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||||||| |||||| |||||||||    
7267498 acaaaaccggcttgtgaggtgatgattgcccccacttataaaca 7267541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 19256587 - 19256662
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
19256587 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19256662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 24075307 - 24075382
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
24075307 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24075382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 38447453 - 38447504
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
38447453 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 38447504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 39052955 - 39053006
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
39052955 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 39053006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 5931980 - 5932026
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||||| |||| |||||| ||||||||||    
5931980 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 5932026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 10614965 - 10615023
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| |||||||| ||||||||||||||| |||| ||||||||| ||||||| ||||||    
10614965 caaccccacaaaatcggcttgtgaggtgaagattacccccatttgtaaacacatgttca 10615023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 11232193 - 11232271
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
11232193 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 11232271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 11232428 - 11232506
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
11232428 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 11232506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 15042669 - 15042747
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||||||||| | |||| |||||||| ||| ||| |||||||||||| |||||| ||||||||||    
15042669 tcttagaaatcgtggttgagcctaacacaaccccacaaaatcggtttgcgaggtgatgattgcccccacttataaacac 15042747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 35682780 - 35682858
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||| ||||||| |||| |||||| ||||||||||    
35682780 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccccacttataaacac 35682858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 37868378 - 37868432
Alignment:
158 gccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||||||||||| |||| |||||| | |||||||| ||||||    
37868378 gccacaaaaccggcttgtgaggtgaggattgcccccactaataaacacgtgttca 37868432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 8466750 - 8466835
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||| ||| |||||| ||||||||||||| ||||  ||||| ||||||||||| |||||  |||||| |||||| ||||| |||||    
8466750 caaccccataaaaccagcttgtgaggtgaggattgtccccacttataaacactcgttcatgccatctcttatccgatgtgagactc 8466835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 205
Target Start/End: Complemental strand, 8929101 - 8929024
Alignment:
128 cttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||  |||| |||||| ||||||||||    
8929101 cttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattgcccccagttataaacac 8929024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 37001284 - 37001231
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacactt 207  Q
    |||| |||||||||||||||||||||||| |||| ||||||  |||||||||||    
37001284 caactccacaaaaccggcttgtgaggtgaggattgcccccacctataaacactt 37001231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 37868614 - 37868667
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||||| ||||||||||||| |||| |||||||| |||||||| ||||||    
37868614 ccacaaaaccagcttgtgaggtgaggattgcccccattaataaacacatgttca 37868667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 7729992 - 7729948
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||| |||| |||||| ||||||||||    
7729992 acaaaaccggcttgtgaggtgaggattgcccccacttataaacac 7729948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 207
Target Start/End: Complemental strand, 37001549 - 37001469
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacactt 207  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||||| |||| ||||  ||||| ||||||||||||    
37001549 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgtgaggattgtccccacttataaacactt 37001469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 10450086 - 10450007
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||||||||| | |||| | ||||||||||||| |||||||| |||| ||| || ||||||||||    
10450086 ctcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattgcccacacttataaacac 10450007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 19256821 - 19256896
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||| ||||||||||||| |||| |||||| |||||||||    
19256821 ttagaaatcgtggttgggcctaacacaaccccacaaaacctgcttgtgaggtgaggattgcccccacttataaaca 19256896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 201
Target Start/End: Complemental strand, 27205246 - 27205171
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataa 201  Q
    ||||||||| | ||| ||| ||||| | |||| ||||||||||||||| |||||||| |||| |||||| ||||||    
27205246 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 193
Target Start/End: Complemental strand, 39960278 - 39960211
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccc 193  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||    
39960278 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccc 39960211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 44931215 - 44931266
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||||| || |||| |||||| |||||||||||| ||||    
44931215 acaaaaccggcttgtgaggcgaggattgcccccacttataaacacttattca 44931266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 4828126 - 4828076
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| ||||  ||||| |||||||||    
4828126 caaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaaca 4828076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 239
Target Start/End: Original strand, 5590369 - 5590479
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatcca 228  Q
    |||||| ||||| ||| ||||| | ||||  |||||||||||||||||| |||| |||| |||||| || ||||||| |  ||| |||||||  |||||     
5590369 ttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccg 5590468  T
229 atgtgtgactc 239  Q
    ||||| |||||    
5590469 atgtgggactc 5590479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 239
Target Start/End: Complemental strand, 5940109 - 5940031
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||||||  ||||||||||||| ||||  |||||||||||||||| |  ||||||||||| | |||| ||||| |||||    
5940109 acaaaacttgcttgtgaggtgaggattgtccccatttataaacacattgtcaaaccatctctcatccgatgtgggactc 5940031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 6541968 - 6541914
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatt-tcccccatttataaacacttgttca 212  Q
    |||||||||||||||||||||||| ||||  |||||| |||||| ||||||||||    
6541968 ccacaaaaccggcttgtgaggtgaggattaccccccacttataagcacttgttca 6541914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 233
Target Start/End: Complemental strand, 20301346 - 20301240
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| | ||| ||| ||||| | ||||  |||||||| |||||||||||| | |||| |||||| |||||||||| |  |||| ||||||  ||||    
20301346 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatc 20301247  T
227 caatgtg 233  Q
    |||||||    
20301246 caatgtg 20301240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 233
Target Start/End: Complemental strand, 21087978 - 21087872
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| | ||| ||| ||||| | ||||  |||||||| |||||||||||| | |||| |||||| |||||||||| |  |||| ||||||  ||||    
21087978 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatc 21087879  T
227 caatgtg 233  Q
    |||||||    
21087878 caatgtg 21087872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 200
Target Start/End: Original strand, 26800514 - 26800584
Alignment:
130 tagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttata 200  Q
    ||||| ||||| ||| ||||| | |||| |||||||||||||||||| ||||| |||| |||||| |||||    
26800514 tagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgtggtgaggattgcccccacttata 26800584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 201
Target Start/End: Complemental strand, 27205049 - 27204975
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataa 201  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||| |||||||| |||| |||||| ||||||    
27205049 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27204975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 201
Target Start/End: Complemental strand, 27205147 - 27205073
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataa 201  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||| |||||||| |||| |||||| ||||||    
27205147 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 34843175 - 34843125
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| | |||| |||||||||    
34843175 caaccccacaaaaccggcttgtgaggtgaggattgctcccacttataaaca 34843125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 37867862 - 37867916
Alignment:
158 gccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||||||||||||||||||||  ||| |||||| | |||||||| ||||||    
37867862 gccacaaaaccggcttgtgaggtgagaattgcccccactaataaacacgtgttca 37867916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 37868102 - 37868156
Alignment:
158 gccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||||| ||||| |||| |||||| | |||||||| ||||||    
37868102 gccacaaaaccggcttgtgtggtgaggattgcccccactaataaacacgtgttca 37868156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 39984872 - 39984822
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| ||||||||| |||||||||||||| |||| |||||| |||||||||    
39984872 caaccccacaaaactggcttgtgaggtgaggattgcccccacttataaaca 39984822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 42846604 - 42846682
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccc-ccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| ||| ||| |||||||||    
42846604 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaaca 42846682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 4963437 - 4963384
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtga 182  Q
    |||||| ||||| ||| ||||| | |||| ||||||||||||||||||||||||    
4963437 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtga 4963384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 239
Target Start/End: Original strand, 12022422 - 12022499
Alignment:
162 caaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||||| ||||||| |||||| ||||||| | | ||||||||||||||| |  ||| || |||||||||||| |||||    
12022422 caaaactggcttgtaaggtgaggatttccgctacttataaacacttgttgaggccacctcttatccaatgtgggactc 12022499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 22638205 - 22638258
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacactt 207  Q
    |||| |||||||||||||||||| ||||| |||| |||| | ||||||||||||    
22638205 caaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaacactt 22638258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 40014711 - 40014658
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||| ||||||| |||| |||| |||||| |||||||||| ||||||    
40014711 ccacaaaaccgacttgtgaagtgaagattgcccccacttataaacacatgttca 40014658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 6559481 - 6559525
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||| |||||| |||| |||||| |||||||||    
6559481 cacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 6559525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 30201555 - 30201599
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaac 203  Q
    |||||||||||||||||||||||| ||||  ||||| ||||||||    
30201555 ccacaaaaccggcttgtgaggtgaagattgaccccacttataaac 30201599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 29)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 160 - 239
Target Start/End: Original strand, 52676305 - 52676384
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||||||| || |||||| |||||| |||||| ||||||||||||||||| ||||||| |||||||||||| |||||    
52676305 cacaaaaccggtttttgaggtcatgattacccccacttataaacacttgttcataccatctcttatccaatgtgggactc 52676384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 127 - 233
Target Start/End: Original strand, 31181512 - 31181618
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| ||||| ||| ||||| | |||| ||| |||||| ||||||||||||| |||| |||||| |||||||||| ||||||  |||||| |||||    
31181512 tcttagaatttgtggttgggcctaacacaaccccataaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaggccatctcttatc 31181611  T
227 caatgtg 233  Q
    |||||||    
31181612 caatgtg 31181618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 52907442 - 52907358
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgact 238  Q
    |||| |||||||||| ||||||||||||| |||| |||||| |||||||||| |||||||||||| | |||||| ||||| ||||    
52907442 caaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaaaccatattttatccgatgtgggact 52907358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 50695833 - 50695918
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||| ||||||||  ||||| |||||| |||||||||||||||||||| ||| |||| ||| || |||||||| ||||||||    
50695833 tcttagaatttgtgcttaggcctaactcaaccccacaaaaccggcttgtgagctgaggattaccctcacttataaacgcttgttca 50695918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 4113005 - 4113083
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
4113005 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 4113083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 26173255 - 26173301
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||||||||||||||||||| |||||| ||||||||||    
26173255 ccacaaaaccggcttgtgaggtgatgattgcccccacttataaacac 26173301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 40079237 - 40079159
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
40079237 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 40079159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 202
Target Start/End: Original strand, 26865356 - 26865432
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    ||||||||| ||||| |||||||||   |||| |||||||||||||||||||||||  |||| |||||| |||||||    
26865356 ctcttagaaattgtggttgagcctaatacaaccccacaaaaccggcttgtgaggtggggattgcccccacttataaa 26865432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 3169849 - 3169774
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
3169849 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaaca 3169774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 126 - 205
Target Start/End: Original strand, 52650769 - 52650848
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| || || ||| ||||| | |||| |||||||||| ||||||||||||| |||| |||||| ||||||||||    
52650769 ctcttagaaattatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacac 52650848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 12244988 - 12245038
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
12244988 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 12245038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 17452680 - 17452753
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||    
17452680 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 17452753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 41035858 - 41035903
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||||||||| |||| |||||| |||||||||    
41035858 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 41035903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 4098433 - 4098513
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||||||  ||||| |||||| |||| |||||| |||||||||| |  ||||||||||| |||||| ||||| |||||    
4098433 ccacaaaaccaacttgtaaggtgaggattgcccccacttataaacacattatcaaaccatctattatccgatgtgcgactc 4098513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 212
Target Start/End: Original strand, 7465681 - 7465729
Alignment:
164 aaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||||| |||| |||||| |||||||||||| ||||    
7465681 aaaccggcttgtgaggtgaggattgcccccacttataaacacttattca 7465729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 17452854 - 17452902
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||    
17452854 caaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaa 17452902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 219
Target Start/End: Complemental strand, 38668413 - 38668353
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatc 219  Q
    ||||||||||| ||||| ||||||||||| |||||| |||||||||| |  ||||||||||    
38668413 ccacaaaaccgacttgtaaggtgatgattgcccccacttataaacacattgtcaaaccatc 38668353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 239
Target Start/End: Complemental strand, 43480422 - 43480346
Alignment:
163 aaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||||||||||||||||||| || | |||||| || ||||||||||||||  |||||| | ||||||| || |||||    
43480422 aaaaccggcttgtgaggtgaggactacccccacttgtaaacacttgttcaggccatctctcatccaatatgggactc 43480346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 25713451 - 25713400
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||||||||| |||||||||||||| |||| |||||| ||||||||||    
25713451 caactccacaaaactggcttgtgaggtgacgattgcccccacttataaacac 25713400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 31004470 - 31004521
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||| ||||||||||||| |||| |||||| |||||||||| ||||||    
31004470 acaaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttca 31004521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 39348378 - 39348429
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||| ||||||||||| |||| |||||| ||||||||||    
39348378 caaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaacac 39348429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 51589075 - 51589000
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| ||| || |||||||||    
51589075 ttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 51589000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 239
Target Start/End: Original strand, 9146587 - 9146665
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||||||||  ||||||||||| |||| |||||| ||||| |||| |||||| ||||||| || ||| ||||| |||||    
9146587 acaaaaccgttttgtgaggtgaggattgcccccagttatatacacatgttcagaccatcttttgtccgatgtgggactc 9146665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 16163220 - 16163174
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||| ||||||||||| |||| |||||| ||||||||||    
16163220 ccacaaaaccggattgtgaggtgaagattgcccccacttataaacac 16163174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 193
Target Start/End: Original strand, 31432229 - 31432295
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccc 193  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||    
31432229 tcttagaaatcgtggttgggcctagcacaaccccacaaaaccggcttgtgaggtgaggattgccccc 31432295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 35772349 - 35772271
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||| |||||| | |||| |||||| ||||||||||    
35772349 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttctgaggtaaggattgcccccacttataaacac 35772271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 51589284 - 51589234
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| ||| || |||||||||    
51589284 caaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 51589234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 2859659 - 2859704
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||||||||||||| |||| |||||| | ||||||||    
2859659 cacaaaaccggcttgtgaggtgaggattacccccactaataaacac 2859704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 9146863 - 9146948
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||| || || |||||| || | |||| ||||||||||||||||||||| || ||||  ||||  ||||||||| |||||||    
9146863 tcttagaaattatggttgagcgtagcacaactccacaaaaccggcttgtgaggagaggattgaccccgcttataaacagttgttca 9146948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 30)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 27656541 - 27656466
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| ||||| ||| ||||| | |||| |||||||||||||||||||||||| ||||||||||| |||||||||    
27656541 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 27656466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 33494624 - 33494512
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||  | ||||| ||||||  ||||    
33494624 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattttcaagccatctcctatc 33494525  T
227 caatgtgtgactc 239  Q
    | ||||| |||||    
33494524 cgatgtgggactc 33494512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 6542969 - 6543048
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtg 233  Q
    |||| ||||||||||||||| ||||||||||||| |||||| |||||||||| |  ||| ||||||| |||||| |||||    
6542969 caaccccacaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttatccgatgtg 6543048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 4868576 - 4868654
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
4868576 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 4868654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 4868812 - 4868890
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
4868812 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 4868890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 9705105 - 9705027
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||| ||||||||||||||||| |||||| ||||||||||    
9705105 tcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgatgattgcccccacttataaacac 9705027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 8026472 - 8026397
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
8026472 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 8026397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 9705312 - 9705261
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
9705312 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 9705261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 21690805 - 21690730
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||||||||| | |||| |||||||| ||||||||||||||| |||| |||||| |||||||||    
21690805 ttagaaatcgtggttgagcctaacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaaca 21690730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 13353286 - 13353208
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
13353286 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 13353208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 19712772 - 19712722
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
19712772 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19712722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 27772772 - 27772722
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
27772772 caactccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 27772722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 33796411 - 33796333
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
33796411 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 33796333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 11721990 - 11721913
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||| |||||||| |||| |||||| |||||||||    
11721990 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaaca 11721913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 202
Target Start/End: Complemental strand, 24554200 - 24554127
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||| || || ||||| ||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||    
24554200 ttagaaattatggttgagactaacacaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaa 24554127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 27653270 - 27653225
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||| |||||||||||| ||||||||||| |||||||||    
27653270 ccacaaaaccgacttgtgaggtgaggatttcccccacttataaaca 27653225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 28867983 - 28868031
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||    
28867983 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 28868031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 2753316 - 2753265
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||||||||||| |||||||||||| |||| |||||| ||||||||||    
2753316 caaccccacaaaaccgccttgtgaggtgaggattacccccacttataaacac 2753265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 17147691 - 17147734
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||||||||||||||||||||| |||| |||||| |||||||    
17147691 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 17147734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 239
Target Start/End: Complemental strand, 30256662 - 30256551
Alignment:
128 cttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatcc 227  Q
    ||||||| | ||| ||| ||||| | |||| |||||||||||| ||||||| ||| |||| |||||| |||||||||| |  ||||||||| | || |||    
30256662 cttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagttgaggattgcccccagttataaacacattgtcaaaccatgtattgtcc 30256563  T
228 aatgtgtgactc 239  Q
     ||||| |||||    
30256562 gatgtgagactc 30256551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 204
Target Start/End: Complemental strand, 13741002 - 13740924
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||| ||||| ||| ||||| | |||| ||||||||||| ||||||| |||| |||| | |||| |||||||||    
13741002 ctcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaaca 13740924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 204
Target Start/End: Complemental strand, 13746502 - 13746424
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||| ||||| ||| ||||| | |||| ||||||||||| ||||||| |||| |||| | |||| |||||||||    
13746502 ctcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaaca 13746424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 25065120 - 25065170
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||| | |||||||||    
25065120 caaccccacaaaaccggcttgtgaggtgaggattgcccctacttataaaca 25065170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 3680298 - 3680253
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||  ||||||||||||||||| |||||| ||||||||||    
3680298 cacaaaaccaacttgtgaggtgatgattgcccccacttataaacac 3680253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 6400877 - 6400922
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||||||||| |||| || ||| |||||||||    
6400877 ccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca 6400922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 194
Target Start/End: Complemental strand, 8026687 - 8026622
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccca 194  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| ||||||    
8026687 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccca 8026622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 12330211 - 12330256
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||||||||||||| | || |||||| ||||||||||    
12330211 cacaaaaccggcttgtgaggtgagggttgcccccacttataaacac 12330256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 19713005 - 19712960
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||||  ||| |||||| |||||||||    
19713005 ccacaaaaccggcttgtgaggtgagaattgcccccacttataaaca 19712960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 27772999 - 27772954
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||| ||||||||||||| |||| |||||| |||||||||    
27772999 ccacaaaaccagcttgtgaggtgaggattgcccccacttataaaca 27772954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 12199837 - 12199881
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||||||||||||||||| |||||| |||||||||    
12199837 cacaaaacggacttgtgaggtgatgattgcccccacttataaaca 12199881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 45)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 35038193 - 35038271
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| ||||||||||| ||||||||||    
35038193 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacac 35038271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 54567977 - 54567899
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| ||||||||||| ||||||||||    
54567977 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacac 54567899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 154 - 231
Target Start/End: Original strand, 23610397 - 23610474
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatg 231  Q
    |||| ||||||||||||| |||||| ||| |||| |||||| |||||||||||||| || ||||||| ||||||||||    
23610397 caaccccacaaaaccggcctgtgagttgaggattacccccacttataaacacttgtccagaccatctcttatccaatg 23610474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 205
Target Start/End: Original strand, 13574922 - 13574998
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||| ||||| ||| ||||| | |||| ||||||||| |||||||||||||| ||||||||||| ||||||||||    
13574922 ttagaaattgtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggatttcccccacttataaacac 13574998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 161 - 232
Target Start/End: Complemental strand, 34221811 - 34221740
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgt 232  Q
    |||||||| ||||||||||||| |||||||||||||||||||||  ||||||  |||||| || ||||||||    
34221811 acaaaacctgcttgtgaggtgaagatttcccccatttataaacatatgttcaggccatctcttgtccaatgt 34221740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 50083112 - 50083158
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||    
50083112 ccacaaaaccggcttgtgaggtgaggatttcccccacttataaacac 50083158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 1723075 - 1723152
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
1723075 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 1723152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 8019053 - 8018976
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| ||||| ||| ||||| | |||| |||||||||||||||||||||||| |||| | |||| |||||||||    
8019053 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcacccacttataaaca 8018976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 11589868 - 11589793
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
11589868 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 11589793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 45138828 - 45138879
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
45138828 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 45138879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 4155409 - 4155331
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||| |||||||| |||| |||||| ||||||||||    
4155409 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttttgaggtgaggattgcccccacttataaacac 4155331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 201
Target Start/End: Original strand, 7697397 - 7697471
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataa 201  Q
    |||||||| ||||| ||  ||||| | |||| |||||||||| |||||||||||||||||| |||||| ||||||    
7697397 tcttagaaattgtggttaggcctaacacaaccccacaaaaccagcttgtgaggtgatgattgcccccacttataa 7697471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 16926948 - 16927026
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| |||||| || | |||| |||||||||||||||||||| ||| |||| |||||| ||||||||||    
16926948 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccggcttgtgagatgaggattacccccacttataaacac 16927026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 20327875 - 20327925
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
20327875 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 20327925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 31317551 - 31317473
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| || ||||| ||||||||||||||||||||| ||||| ||||||||||    
31317551 tcttagaaatcgtggttgggcctaacacaaccccgcaaaatcggcttgtgaggtgatgattttccccacttataaacac 31317473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 239
Target Start/End: Complemental strand, 39269381 - 39269304
Alignment:
162 caaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||||||||||||||||| |||| |||||| |||||||||| |  ||| ||||| || | ||||||||| |||||    
39269381 caaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtgctctccaatgtgggactc 39269304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 45828304 - 45828219
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||| |||||||||| ||||||||||||  |||| |||||| |||||||||| ||||||  |||||| || ||| ||||| |||||    
45828304 caaccccacaaaacctgcttgtgaggtggagattgcccccacttataaacacatgttcaggccatcttttgtccgatgtgggactc 45828219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 20327640 - 20327688
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||    
20327640 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 20327688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 20479060 - 20479016
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||| ||||||||||||||| ||||||||||| |||||||||    
20479060 cacaaaaacggcttgtgaggtgaggatttcccccacttataaaca 20479016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 22729185 - 22729073
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| ||||| ||| ||||| | ||||  |||||||||||||||||| |||| |||| |||||| || ||||||| |  ||| |||||||  ||||    
22729185 tcttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatc 22729086  T
227 caatgtgtgactc 239  Q
    | ||||| |||||    
22729085 cgatgtgggactc 22729073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23691224 - 23691268
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23691224 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23691268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23708024 - 23708068
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23708024 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23708068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23708256 - 23708300
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23708256 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23708300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23726480 - 23726524
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23726480 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23726524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23726712 - 23726756
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23726712 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23726756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23744936 - 23744980
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23744936 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23744980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23745168 - 23745212
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
23745168 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23745212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 24063461 - 24063505
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
24063461 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24063505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 24063693 - 24063737
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| |||| |||||| |||||||||    
24063693 cacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24063737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 472086 - 472137
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||| | |||| |||||| ||||||||||    
472086 caaccccacaaaaccggcttgtgaggtaaggattgcccccacttataaacac 472137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 1681757 - 1681690
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatcc 227  Q
    ||||||||||||||||| |||||||||| | |||| |||||||||| |||| |  |||||| ||||||    
1681757 cacaaaaccggcttgtggggtgatgattacacccacttataaacacatgtttaggccatcttttatcc 1681690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 45138997 - 45139048
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||| |||||    
45138997 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaacac 45139048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 54368574 - 54368523
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||| |||||||||||||||||||| |||| |||||| ||||||||||    
54368574 caaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacac 54368523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 9273019 - 9272969
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| | || |||||| |||||||||    
9273019 caaccccacaaaaccggcttgtgaggtgagggttgcccccacttataaaca 9272969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 16239644 - 16239598
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||||| | || |||||| ||||||||||    
16239644 ccacaaaaccggcttgtgaggtgaggtttgcccccacttataaacac 16239598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 16239912 - 16239835
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgattt-cccccatttataaaca 204  Q
    |||||||| |||||||||  |||| | |||| ||||||||||| |||||||||||| ||||| |||||| |||||||||    
16239912 tcttagaaattgtgcttggacctaacacaaccccacaaaaccgacttgtgaggtga-gatttgcccccacttataaaca 16239835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 31317313 - 31317236
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||||||||| | |||  |||||||||||||||||||||||| || || ||||| ||||||||||    
31317313 tcttagaaatcgtggttgagcctaacacaatcccacaaaaccggcttgtgaggtgagga-ttgccccacttataaacac 31317236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 45828104 - 45828027
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| ||||| | | ||||| | ||||  ||||||||||||||||||||||| |||| |||| | |||||||||    
45828104 tcttagaaattgtggtagggcctaacacaacctcacaaaaccggcttgtgaggtgaggattgccccaacttataaaca 45828027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 1800273 - 1800225
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||| |||||||||||| ||||||||||| |||| |||||| |||||||    
1800273 caaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaa 1800225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 202
Target Start/End: Original strand, 20303078 - 20303138
Alignment:
142 ttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    ||||||||| | |||  |||||||||||| ||||||||||| |||| |||||| |||||||    
20303078 ttgagcctaacacaatcccacaaaaccggtttgtgaggtgaggattgcccccacttataaa 20303138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23691456 - 23691500
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| |||||||||||||||| |||| |||||| |||||||||    
23691456 cacaaatccggcttgtgaggtgaggattgcccccacttataaaca 23691500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 187
Target Start/End: Complemental strand, 24866282 - 24866222
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatt 187  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| ||||    
24866282 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatt 24866222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 187
Target Start/End: Original strand, 28087246 - 28087274
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatt 187  Q
    |||||||||||||||||||||||||||||    
28087246 ccacaaaaccggcttgtgaggtgatgatt 28087274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 239
Target Start/End: Complemental strand, 41915220 - 41915144
Alignment:
163 aaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||| || ||||||||||| |||| |||||| |||||||||| ||||||   ||||| || ||||||||| |||||    
41915220 aaaactggtttgtgaggtgaggattgcccccacttataaacacatgttcatgtcatctcttttccaatgtgggactc 41915144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 50930760 - 50930704
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgtt 210  Q
    |||| |||||||||||  ||||||||||| |||| |||||| |||||||||| ||||    
50930760 caaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaacacatgtt 50930704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 42)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 16419588 - 16419509
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
16419588 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 16419509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 205
Target Start/End: Original strand, 40379207 - 40379286
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
40379207 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 40379286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 204
Target Start/End: Complemental strand, 2324544 - 2324482
Alignment:
142 ttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
2324544 ttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 2324482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 239
Target Start/End: Complemental strand, 8227400 - 8227322
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||||| || || |||||| |||| |||||| |||||||||||||||||  |||||| | ||||||||||||||||    
8227400 acaaaaccgcctcgtaaggtgaggattgcccccacttataaacacttgttcatgccatctctcatccaatgtgtgactc 8227322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 36352158 - 36352236
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||| || ||||| |||| |||| | |||| ||||||||||||||| ||||||||||||| |||||| ||||||||||    
36352158 tcttaaaaattgtggttgaacctaacacaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaacac 36352236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 40379443 - 40379521
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
40379443 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 40379521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 28407792 - 28407869
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
28407792 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 28407869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 37840395 - 37840344
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||||||||||||||||||||||||||||| || ||| ||||||||||    
37840395 caaccccacaaaaccggcttgtgaggtgatgattgcctccacttataaacac 37840344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 2324298 - 2324248
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
2324298 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 2324248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 5711438 - 5711516
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
5711438 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgttaggtgaggattgcccccacttataaacac 5711516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 5711674 - 5711752
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||| | ||||||||||| |||||| ||||||||||    
5711674 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttttaaggtgatgattgcccccacttataaacac 5711752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 15988265 - 15988223
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    ||||||||||||||||||||||| ||||||||||| |||||||    
15988265 cacaaaaccggcttgtgaggtgaggatttcccccacttataaa 15988223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 17525369 - 17525415
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||||| |||| |||||| ||||||||||    
17525369 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 17525415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 17719485 - 17719407
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||| ||| | | |||| | |||||||||||||||||||||| |||| |||||| ||||||||||    
17719485 tcttagaaattgtggttgggccgaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 17719407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 32884165 - 32884115
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
32884165 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 32884115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 33606316 - 33606366
Alignment:
155 aacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||||||| |||||||||||||| |||| |||||| ||||||||||    
33606316 aacgccacaaaactggcttgtgaggtgaggattacccccacttataaacac 33606366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 226
Target Start/End: Original strand, 25082563 - 25082635
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||| ||||||||| ||||||||||||||||||| |||| | |||||||||| |  ||| ||||||| |||||    
25082563 caaccccacaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcagaccatctcttatc 25082635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 30006611 - 30006663
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||| ||||||||||  ||||| |||||||||| ||||||    
30006611 cacaaaaccggcttgtgtggtgatgattatccccacttataaacacatgttca 30006663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 30063299 - 30063351
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    ||||||||||||||||| ||||||||||  ||||| |||||||||| ||||||    
30063299 cacaaaaccggcttgtgtggtgatgattatccccacttataaacacatgttca 30063351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 2029827 - 2029776
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| || ||| ||||||||||    
2029827 caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac 2029776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 2030062 - 2030011
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| || ||| ||||||||||    
2030062 caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac 2030011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 19191611 - 19191686
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| ||||  ||||| |||||||||    
19191611 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaaca 19191686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 42639640 - 42639691
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||| ||||||||||||| ||||  ||||||||||||||||    
42639640 caaccccacaaaaccagcttgtgaggtgacgattgtccccatttataaacac 42639691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 5509137 - 5509087
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||| ||||||||||||| |||| |||||| |||||||||    
5509137 caaccccacaaaaccagcttgtgaggtgaggattacccccacttataaaca 5509087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 14466409 - 14466487
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| | |||| ||||||||||    
14466409 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgctcccacttataaacac 14466487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 17854955 - 17855005
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| ||| || |||||||||    
17854955 caaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 17855005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 19544402 - 19544447
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||||||||| |||| |||||| ||||||||||    
19544402 ccacaaaaccggcttgtgaggtga-gattgcccccacttataaacac 19544447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 29718386 - 29718336
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| ||| || |||||||||    
29718386 caaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 29718336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 37769969 - 37770019
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| ||||||||||||||| |||||||| |||| |||||| |||||||||    
37769969 caaccccacaaaaccggcttatgaggtgaagattgcccccacttataaaca 37770019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 40718233 - 40718283
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||| |||||||||||||||| ||| || |||||||||    
40718233 caactccacaaaaccggtttgtgaggtgatgattgccctcacttataaaca 40718283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 93479 - 93520
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataa 201  Q
    ||||||||||||||||||||||| |||| |||||| ||||||    
93479 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 201
Target Start/End: Original strand, 93752 - 93793
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataa 201  Q
    ||||||||||||||||||||||| |||| |||||| ||||||    
93752 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 94052 - 94097
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||| |||||||||||| |||| |||||| ||||||||||    
94052 cacaaaaccgacttgtgaggtgaggattgcccccacttataaacac 94097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 5509366 - 5509321
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||| ||||| |||| |||||| |||||||||    
5509366 ccacaaaaccggcttgtggggtgaggattgcccccacttataaaca 5509321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 202
Target Start/End: Complemental strand, 8424971 - 8424898
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||| | ||| |||||| || | |||| ||||||||| || |||||||||||||||| |||||| |||||||    
8424971 ttagaaatcgtggttgagcttaacacaaccccacaaaactggtttgtgaggtgatgattgcccccacttataaa 8424898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 16533599 - 16533554
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||||||||||| |||| |||| |||||| ||||||||||    
16533599 cacaaaaccggcttgtgaagtgaggattgcccccacttataaacac 16533554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 203
Target Start/End: Complemental strand, 17719652 - 17719575
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaac 203  Q
    ||||||||| | ||| ||| ||||| | |||| |||||||||||| ||||||||| | |||| |||||| ||||||||    
17719652 ctcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtcaggattgcccccacttataaac 17719575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 17854723 - 17854768
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||| |||||||| |||||||| |||||| |||||||||    
17854723 ccacaaaaccgacttgtgagatgatgattgcccccacttataaaca 17854768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 225
Target Start/End: Complemental strand, 18209036 - 18208975
Alignment:
164 aaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttat 225  Q
    |||||| ||| ||||||||||||| | ||||||||||||||| |||||| | ||||| ||||    
18209036 aaaccgacttatgaggtgatgattgctcccatttataaacacatgttcatatcatcttttat 18208975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 187
Target Start/End: Complemental strand, 10571055 - 10570995
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatt 187  Q
    |||||||| | ||| ||||||||| | |||| ||||||||||||||||| |||||| ||||    
10571055 tcttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaagatt 10570995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 15988465 - 15988386
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    ||||||||| |||||||||||||| |||| |||||| |||| ||||| ||||||| || ||| || ||| ||||| |||||    
15988465 ccacaaaactggcttgtgaggtgaggattgcccccacttat-aacacatgttcaagccttcttttgtccgatgtgggactc 15988386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 33606085 - 33606165
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||||||||||| ||||||||||| |||| |||| | |||||||||| | ||||  ||||||  ||||| ||||| |||||    
33606085 ccacaaaaccggtttgtgaggtgaggattgcccctacttataaacacattttcaggccatctcctatccgatgtgggactc 33606165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0334
Description:

Target: scaffold0334; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 142 - 204
Target Start/End: Original strand, 4443 - 4505
Alignment:
142 ttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
4443 ttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 4505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 35)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 25620221 - 25620143
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
25620221 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 25620143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 21054952 - 21055029
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
21054952 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 21055029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 40898921 - 40899006
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||| | ||| ||||||||| | |||  ||| |||||| |||||||||||||||||| |||||| |||||||||| ||||||    
40898921 tcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacatgttca 40899006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 233
Target Start/End: Complemental strand, 47849647 - 47849550
Alignment:
136 ttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtg 233  Q
    ||||| ||||||||| | |||  |||||||||||| ||||||||||| |||| |||| | |||||||||| ||||||  |||||| |||||| |||||    
47849647 ttgtggttgagcctaacacaagcccacaaaaccgggttgtgaggtgaggattgccccaacttataaacacatgttcatgccatcttttatccgatgtg 47849550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 23839109 - 23839153
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||||||| ||||||||||| |||||||||    
23839109 cacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 23839153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 26562074 - 26562149
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||||||||| |  ||| |||||||||||||||||||||||| |||| |||||| |||||||||    
26562074 ttagaaatggtggttgagcctaacataaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaaca 26562149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 34027476 - 34027401
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| |||||||||||||||||||||||| |||| |||||| |||||||||    
34027476 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 34027401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 48243087 - 48243138
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||| |||| |||||| ||||||||||    
48243087 caaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 48243138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 9689123 - 9689181
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatc 219  Q
    |||||||||||||||||||||| ||||||||||| |||||| ||| |  ||||||||||    
9689123 acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatc 9689181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 47710528 - 47710450
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||| |||||||||||||| |||| |||||| ||||||||||    
47710528 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacac 47710450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 47722184 - 47722106
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||| |||||||||||||| |||| |||||| ||||||||||    
47722184 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacac 47722106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 1793804 - 1793721
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatccaatgtgtgactc 239  Q
    |||| |||||||||| ||||||||||||| |||| |||||| | ||||||| ||| ||| ||||||| |||||||||||| |||||    
1793804 caaccccacaaaacctgcttgtgaggtgaggattgcccccactaataaaca-ttg-tcagaccatctcttatccaatgtgagactc 1793721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 10882036 - 10882081
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||||||||||||||||||| |||| |||||| |||||||||    
10882036 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 10882081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 34027712 - 34027635
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||||| |||| |||| |||||| |||||||||    
34027712 tcttagaaatcgtgattgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgcccccacttataaaca 34027635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 205
Target Start/End: Complemental strand, 29469688 - 29469612
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
29469688 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 29469612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 205
Target Start/End: Complemental strand, 29469923 - 29469847
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
29469923 ttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 29469847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 207
Target Start/End: Original strand, 30727117 - 30727197
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacactt 207  Q
    |||||||| ||||| ||| ||||| || |||   |||||||| ||||||||||||| |||| |||||| ||||||||||||    
30727117 tcttagaaattgtggttgggcctaacttaaccgtacaaaaccagcttgtgaggtgaggattgcccccacttataaacactt 30727197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 3038110 - 3038161
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| ||||||||||||||||||| |||| |||| |||||| ||||||||||    
3038110 caaccccacaaaaccggcttgtgacgtgaggattgcccccacttataaacac 3038161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 212
Target Start/End: Original strand, 21213058 - 21213125
Alignment:
145 agcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||| | |||| ||||||||||  ||||||||||||||||| | |||| |||||||||| ||||||    
21213058 agcctaacacaactccacaaaaccaacttgtgaggtgatgattactcccacttataaacacatgttca 21213125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 194
Target Start/End: Complemental strand, 32474585 - 32474518
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccca 194  Q
    |||||||| ||||| ||| ||||| | |||  |||||||||||||||||||||||| |||| ||||||    
32474585 tcttagaaattgtggttgggcctaacgcaaacccacaaaaccggcttgtgaggtgaggattgccccca 32474518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 202
Target Start/End: Original strand, 33996310 - 33996385
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaa 202  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||| |||||||||||| |||| |||||| |||||||    
33996310 tcttagaaatcgtggttgggcctaacacaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaa 33996385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 2544473 - 2544523
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| ||||||||||| |||||||||||| |||| |||||| |||||||||    
2544473 caaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaaca 2544523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Complemental strand, 10903143 - 10903093
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| |||| |||| | |||||||||    
10903143 caactccacaaaaccggcttgtgaggtgaggattacccctacttataaaca 10903093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 233
Target Start/End: Complemental strand, 15317637 - 15317532
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaaccatctgttatc 226  Q
    |||||||| || || ||| ||||| | |||| |||||||||  | ||||||||||| |||| |||||| |||||||||| || |||  |||||| |||||    
15317637 tcttagaaattatggttgggcctaacacaacaccacaaaactagtttgtgaggtgaggattgcccccacttataaacacatg-tcaggccatcttttatc 15317539  T
227 caatgtg 233  Q
    |||||||    
15317538 caatgtg 15317532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 204
Target Start/End: Original strand, 23794370 - 23794432
Alignment:
142 ttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||| |||||  ||||||||  |||||||||||||| |||| || |||||||||||||    
23794370 ttgagcctaactcaatcccacaaaattggcttgtgaggtgaggattgccaccatttataaaca 23794432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 26239915 - 26239993
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| ||| | ||| | |||| |||||| |||| |||||||||||| |||| |||||| ||||||||||    
26239915 tcttagaaattgtggttgggtctaacacaaccccacaataccgacttgtgaggtgaggattgcccccacttataaacac 26239993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 32292577 - 32292519
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| ||||||| |||||||||||||||| ||   |||||| |||||||||||||||||    
32292577 caaccccacaaatccggcttgtgaggtgaggaccgcccccacttataaacacttgttca 32292519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 43085536 - 43085614
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| |||||| || | |||| ||||||||||  |||||||||||| |||| |||||| ||||||||||    
43085536 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacac 43085614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4268103 - 4268062
Alignment:
163 aaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||| ||||||||||||| |||||| |||||||||    
4268103 aaaaccggcttttgaggtgatgattgcccccacttataaaca 4268062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 38843081 - 38843024
Alignment:
159 ccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttcaaacc 216  Q
    |||||||||||  || ||||||||||||| || | |||||||||||| ||||||||||    
38843081 ccacaaaaccgatttatgaggtgatgattgcctctatttataaacacatgttcaaacc 38843024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 4454827 - 4454783
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||| ||||||||||| |||| |||||| ||||||||||    
4454827 acaaaaccggtttgtgaggtgaggattgcccccacttataaacac 4454783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 204
Target Start/End: Complemental strand, 4886377 - 4886337
Alignment:
164 aaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    ||||||||||||||||||| |||| |||||||| |||||||    
4886377 aaaccggcttgtgaggtgaggattgcccccattaataaaca 4886337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 35308179 - 35308223
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||||  |||||||||||||||| |||||| ||||||||||    
35308179 acaaaaccgaattgtgaggtgatgattgcccccacttataaacac 35308223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 40746550 - 40746506
Alignment:
160 cacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||||| |||||||||||||  ||||||||||| |||||||||    
40746550 cacaaaactggcttgtgaggtgtggatttcccccacttataaaca 40746506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 44874379 - 44874423
Alignment:
161 acaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||| ||| ||||||||||| ||||||||||| ||||||||||    
44874379 acaaaatcggtttgtgaggtgaggatttcccccacttataaacac 44874423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 67363 - 67278
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||||||| | ||| ||||||||| | |||  ||| |||||| |||||||||||||||||| |||||| |||||||||| ||||||    
67363 tcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacatgttca 67278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 14361 - 14310
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||||||||||||||||||||||||  ||||| ||||||||||    
14361 caaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaacac 14310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 56542 - 56467
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||||| | ||| ||| ||||| | |||| ||||||||||||||||||||||||||||| ||| || |||||||||    
56542 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaaca 56467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 2001 - 1923
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
2001 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 1923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 2236 - 2158
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| ||||||||||||||||| |||||| |||| |||||| ||||||||||    
2236 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacac 2158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 51321 - 51243
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| ||||| |||||| || | |||| ||||||||| | |||||||||||| |||| |||||| ||||||||||    
51321 tcttagaaattgtgattgagcataacacaaccccacaaaactgacttgtgaggtgaggattgcccccacttataaacac 51243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 347597 - 347655
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacacttgttca 212  Q
    |||| |||||||||||||||||||||| | || | |||||| |||||||||||||||||    
347597 caaccccacaaaaccggcttgtgaggtaaagactgcccccaattataaacacttgttca 347655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0766
Description:

Target: scaffold0766; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 6332 - 6281
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||| |||||||| ||||||||||||||| |||| |||||| ||||||||||    
6332 caaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacac 6281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 82162 - 82083
Alignment:
126 ctcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    ||||||||| ||||| ||| ||||| | |||| |||||||||||| |||| |  ||| ||||||||||||||||| ||||    
82162 ctcttagaaattgtggttgggcctaacacaaccccacaaaaccggtttgtaatttgaggatttcccccatttatatacac 82083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0692
Description:

Target: scaffold0692; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 5543 - 5621
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| || || ||| ||||| | |||| || |||||||||||||||| |||| |||| |||||| ||||||||||    
5543 tcttagaaattatggttgggcctaacacaaccccgcaaaaccggcttgtgaagtgaggattgcccccacttataaacac 5621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 5753 - 5831
Alignment:
127 tcttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaacac 205  Q
    |||||||| | ||| ||| ||||| | |||| || ||||||||||||||||| ||| |||| |||||| ||||||||||    
5753 tcttagaaatcgtggttgggcctaacacaaccccgcaaaaccggcttgtgagatgaggattgcccccacttataaacac 5831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 204
Target Start/End: Original strand, 3497 - 3547
Alignment:
154 caacgccacaaaaccggcttgtgaggtgatgatttcccccatttataaaca 204  Q
    |||| |||||||||||||||||||||||| ||||  ||||| |||||||||    
3497 caaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaaca 3547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0400 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0400
Description:

Target: scaffold0400; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 193
Target Start/End: Complemental strand, 3928 - 3864
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccc 193  Q
    |||||| ||||| ||| ||||| | |||| ||||||||| |||||||||||||| |||| |||||    
3928 ttagaaattgtggttgtgcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccc 3864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 193
Target Start/End: Complemental strand, 4572 - 4508
Alignment:
129 ttagaacttgtgcttgagcctacctcaacgccacaaaaccggcttgtgaggtgatgatttccccc 193  Q
    |||||| ||||| ||| ||||| | |||| ||||||||| |||||||||||||| |||| |||||    
4572 ttagaaattgtggttgtgcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccc 4508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University