View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_high_68 (Length: 227)
Name: NF10602_high_68
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 10972169 - 10971953
Alignment:
| Q |
1 |
gttaccttgaggaggaagctattcactcatacactgagtttctcaaggaacttgataaaggcaacatcgaaaacgttcctgctccagctattgctattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10972169 |
gttaccttgaggaggaagctattcactcatacactgagtttctcaaggaacttgataaaggcaacatcgaaaacgttcctgctccagctattgctattga |
10972070 |
T |
 |
| Q |
101 |
ctattggcagcttccccaaaactctactttaagggatgttgtagaggttgtcagagctgatgaagcacatcatcgcgatgttaaccactttgcatcggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10972069 |
ctattggcagcttccccaaaactctactttaagggatgttgtagaggttgtcagagctgatgaagcacatcatcgcgatgttaaccattttgcttcggta |
10971970 |
T |
 |
| Q |
201 |
tgttgtctatccctttg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10971969 |
tgttgtctatccctttg |
10971953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University