View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_high_75 (Length: 222)
Name: NF10602_high_75
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_high_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 25304092 - 25303890
Alignment:
| Q |
1 |
atcgtttgaatacaaatcatttagaagaatatacggagaagtgtgctcggcttgttattcaggaggaggccttttggaaacaaagagctaagatgcactg |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25304092 |
atcgtgtgaatacaaatcatttagaagaaaatatggagaagtgtgctcggcttgttattcaggaggaggccttttggaaacaaagagctaagatgcactg |
25303993 |
T |
|
| Q |
101 |
gttgaaacaaagggacgtgaatacaaggttcttttacatgtccactgtttcgagaggtaaagtcaagaaagttataaaactggtgtctgataatggttat |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
25303992 |
gttgaaacaaagggacgtgaatagaaggttcttttacatgtccactgtttctagaggtaaagtcaagaaagttacaaaactggtgtttgataatggttat |
25303893 |
T |
|
| Q |
201 |
ttg |
203 |
Q |
| |
|
||| |
|
|
| T |
25303892 |
ttg |
25303890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 106
Target Start/End: Original strand, 7124477 - 7124523
Alignment:
| Q |
60 |
caggaggaggccttttggaaacaaagagctaagatgcactggttgaa |
106 |
Q |
| |
|
||||||||||| |||||||| |||||||| || |||||||||||||| |
|
|
| T |
7124477 |
caggaggaggcgttttggaagcaaagagcaaaaatgcactggttgaa |
7124523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University