View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_high_79 (Length: 219)
Name: NF10602_high_79
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_high_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 31797823 - 31797622
Alignment:
| Q |
1 |
tagaataaataagatcagaaatttcaattatatgcacgaagatatgttttctcataagaactttggagttgaaacagattatacttgttgcacacaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31797823 |
tagaataaataagatcagaaatttcaattatatgcacgaagatatgttttctcataagaactttggagttgaaacagattatacttgttgcacacaaact |
31797724 |
T |
|
| Q |
101 |
ttgtataatgatgctagtagttggtgtacaacgagcagtgccatttttcatgaccataagtattcactatatcatccaatatgtaaaattgagcttatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31797723 |
ttgtataatgatgctagtagttggtgtacaacgagcagtgccatttttcatgaccataagtattcactaaatcatccaatatgtaaaattgagcttatga |
31797624 |
T |
|
| Q |
201 |
aa |
202 |
Q |
| |
|
|| |
|
|
| T |
31797623 |
aa |
31797622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 81
Target Start/End: Complemental strand, 31787378 - 31787308
Alignment:
| Q |
11 |
aagatcagaaatttcaattatatgcacgaagatatgttttctcataagaactttggagttgaaacagatta |
81 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
31787378 |
aagatcggacatttcaattatatgcacgaagatatgatttctcacaagaactttggagttgaaagagatta |
31787308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 31787210 - 31787163
Alignment:
| Q |
153 |
accataagtattcactatatcatccaatatgtaaaattgagcttatga |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| | ||||||| |
|
|
| T |
31787210 |
accataagtattcactatatcatcaaataggtaaaatttatcttatga |
31787163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University